Uracil recognition by replicative DNA polymerases is limited to the archaea, not occurring with bacteria and eukarya

Abstract

Family B DNA polymerases from archaea such as Pyrococcus furiosus, which live at temperatures approximately 100 degrees C, specifically recognize uracil in DNA templates and stall replication in response to this base. Here it is demonstrated that interaction with uracil is not restricted to hyperthermophilic archaea and that the polymerase from mesophilic Methanosarcina acetivorans shows identical behaviour. The family B DNA polymerases replicate the genomes of archaea, one of the three fundamental domains of life. This publication further shows that the DNA replicating polymerases from the other two domains, bacteria (polymerase III) and eukaryotes (polymerases delta and epsilon for nuclear DNA and polymerase gamma for mitochondrial) are also unable to recognize uracil. Uracil occurs in DNA as a result of deamination of cytosine, either in G:C base-pairs or, more rapidly, in single stranded regions produced, for example, during replication. The resulting G:U mis-pairs/single stranded uracils are promutagenic and, unless repaired, give rise to G:C to A:T transitions in 50% of the progeny. The confinement of uracil recognition to polymerases of the archaeal domain is discussed in terms of the DNA repair pathways necessary for the elimination of uracil.

Figure 1.

The amino acids that form the uracil-binding pocket of Pfu-Pol (2) are shown (numbers above refer to the positions of amino acids in the Pfu-Pol sequence). An alignment is shown for the corresponding amino acids in Mac-Pol and yeast Pols δ and ε. Homology is excellent between Pfu-Poland Mac-Pol and partial between Pfu-Pol and the two yeast enzymes. A more comprehensive table showing more species is given in the Supplementary Material.

Figure 2.

Primer-template extension assays. In all cases the following primer-template was used: GCAGTCCTAGACGCAG CGTCAGGATCTGCGTCCTATCG(T/U)GG(T/U)GCCTAC. The templates contain a single uracil (thymine in controls) either 7 or 10 bases ahead of the primer-template junction. The polymerases under investigation are shown above each panel. Individual gel lanes are labelled: P (primer); polymerase not added, serves as marker for migration of unextended 16-mer primer. EP (extended primer, only used with Pol γ), chemically synthesized 32-mer corresponding to fully extended primer, serves as marker for full extension. T (thymine), control template lacking uracil. U7/U10; templates containing uracil either 7 or 10 bases ahead of primer-template junction. The archaeal polymerases Mac-Pol and Pfu-Pol fully extend the primer when the template lacks uracil. In contrast, the presence of uracil in the template strand leads to truncated products due to uracil-induced stalling of polymerization. All other polymerase (yeast Pols δ and ε, E. coli PolIII* and mitochondrial Pol γ) fully extend the primer regardless of whether uracil is present or not in the template.

Figure 3.

Binding titration for Pfu-Pol (black circles) and Mac-Pol (white circles). The polymerases were added to Hex-GCCCGCGGGAUATCGGCCCTTA (6 nM) and the fluorescence anisotropy measured (the same number of measurements were carried out for both polymerases; in some cases the white circles obscure the black). The titration was carried out three times to give a K_D of 8.5 ± 1.3 nM for Pfu-Pol and 9.7 ± 1.6 nM for Mac-Pol.