A viable Bacillus subtilis strain without functional extracytoplasmic function sigma genes

Abstract

We constructed a Bacillus subtilis Marburg strain that harbors deletion mutations in all seven extracytoplasmic function (ECF) sigma genes. The strain shows wild-type growth at 37 degrees C both in a complex and in a synthetic medium and exhibits wild-type sporulation. ECF sigma genes of B. subtilis are dispensable as long as no stress is imposed, although they seem to be required for quick response to stresses.

FIG. 1.

One path to an ECF sigma-free strain. (A) The first step, ΔsigY strain construction. Detailed procedures are described in the text. (B) Successive procedures used to construct the B. subtilis mutant strain BSU2007 carrying deletions in all ECF genes. The initial strain, carrying sigY::cm, was B. subtilis Marburg 168 trpC2.

FIG. 2.

PCR confirmation of deletion mutations in ECF sigma genes of B. subtilis BSU2007. Lanes 1 and 2, sigM; lanes 3 and 4, sigV; lanes 5 and 6, sigW; lanes 7 and 8, sigX; lanes 9 and 10, sigY; lanes 11 and 12, sigZ; lanes 13 and 14, ylaC. Odd numbers indicate PCR products with 168 DNA as a template. Even numbers indicate PCR products with BSU2007 DNA as a template. The primer pairs were as follows: 5′ GTCGTCGACGTGTATAACATAGAGGGG/5′ GCAGCATGCAGTCATTTCCTGGTCG for sigM, 5′ GTCGTCGACGTATATTCAAAAAGGAGCCC/5′ GCAGCATGCTGTAATCTCTTATCCATTAAG for sigV, 5′ GTCGTCGACCGGTGAAGGCAGAGG/5′ GCAGCATGCATAAGCTGCACAATTTG for sigW, 5′ GAAGAATTCCGACAAAACGGTAAAATCGAG/5′ GGAGGATCCTTTTCAGGAACGACAAAC for sigX, 5′ GAAGAATTCAATGCATCGTCCTCC/5′ GCAGCATGCTTATTCATCATCCCACTCC for sigY, 5′ GTCGTCGACGCAAAATTATAGGAGG/5′ GCAGCATGCAAACATCAAAGGAAAAATGC for sigZ, and 5′ GTCGTCGACATTTGGATGACGGTGTGG/5′ GCAGCATGCTTTCCAATTCAAATGGC for ylaC. The lengths of the PCR products were 594 bases (159 bases), 558 bases (93 bases), 647 bases (110 bases), 1424 bases (938 bases), 759 bases (261 bases), 1,204 bases (751 bases), and 709 bases (229 bases) for sigM (ΔsigM), sigV (ΔsigV), sigW (ΔsigW), sigX (ΔsigX), sigY (ΔsigY), sigZ (ΔsigZ), and ylaC (ΔylaC), respectively.

FIG. 3.

Slow growth of the ECF sigmaless strain BSU2007 of B. subtilis in Difco nutrient broth medium. A portion of an overnight culture in LB medium was transferred to fresh medium and incubated at 37°C. Filled ovals, wild-type strain 168; open ovals, BSU2007. (A) LB broth. (B) Bacto nutrient broth (Difco Laboratories, Detroit, MI). (C) Minimal glucose medium (1).

FIG. 4.

Slow growth recovery from temperature shift of ECF sigmaless strain BSU2007. Rapidly growing cells of wild-type strain 168 (filled ovals) or BSU2007 (open ovals) in LB broth were transferred from 37°C to 52°C at time zero. OD₆₀₀, optical density at 600 nm.