Quick identification of Type I restriction enzyme isoschizomers using newly developed pTypeI and reference plasmids

Abstract

Although DNA-recognition sequences are among the most important characteristics of restriction enzymes and their corresponding methylases, determination of the recognition sequence of a Type-I restriction enzyme is a complicated procedure. To facilitate this process we have previously developed plasmid R-M tests and the computer program RM search. To specifically identify Type-I isoschizomers, we engineered a pUC19 derivative plasmid, pTypeI, which contains all of the 27 Type-I recognition sequences in a 248-bp DNA fragment. Furthermore, a series of 27 plasmids (designated 'reference plasmids'), each containing a unique Type-I recognition sequence, were also constructed using pMECA, a derivative of pUC vectors. In this study, we tried those vectors on 108 clinical E. coli strains and found that 48 strains produced isoschizomers of Type I enzymes. A detailed study of 26 strains using these 'reference plasmids' revealed that they produce seven different isoschizomers of the prototypes: EcoAI, EcoBI, EcoKI, Eco377I, Eco646I, Eco777I and Eco826I. One strain EC1344 produces two Type I enzymes (EcoKI and Eco377I).

Figure 1.

pTypeI plasmid and relevant DNA sequence. A 248-bp fragment containing all 27 naturally occurring Type I sequences was cloned in the HincII site (blunt end) of pUC19. This insert contains 17 Type I sequences (Fragment A) found in E. coli and 10 Type I sequences (Fragment B) found in other bacteria. The 248-bp insert starts and ends at an EcoRV site. Another EcoRV site is located at the boundary of fragments A and B such that those two fragments can be easily subcloned into other vectors. The left side (MCS left) contains half of the original MCS sequences of pUC19: EcoRI, SacI, KpnI, SmaI, XmaI, BamHI, XbaI and ends at the remnant of HincII (GTC)–the cloning site. This MCS left portion is shown above as a linear bar extending from the 248-bp insertion fragment, rather than as a part of the circular plasmid. A nearly identical MCS fragment was added to the right end of the synthetic fragment (MCS right), where restriction sites are colored. Therefore, the entire group of Type I sequences can be cut out as a cassette using any of those enzymes except for SacI. The right end of the 248-bp fragment is an EcoRV site which is connected to the cleaved other half of the HincII site (GAC), thus the original HincII site was lost in this cloning process. In the design of the 248-bp fragment, a few convenient unique restriction sites were added. These are PsiI, SnaBI, PmlI, and ScaI (all underlined).

Figure 2.

A diagram illustrating the design of a reference plasmid, pEcoBI, as an example of the reference plasmid construction. In the actual experiment, a 21mer (ATCTGAGTACGCGTTGCTGAT) that contains a single EcoBI sequence (underlined) was cloned in the single EcoRV site (blunt end) located in the MCS site in pMECA (13). The final product is an EcoBI sequence flanked by EcoRV sequences. This sequence also contains a MluI sequence (ACGCGT) in the random sequence (NNNNNNNN) region for easy identification of the cloned fragment.