Small CRISPR RNAs guide antiviral defense in prokaryotes

Abstract

Prokaryotes acquire virus resistance by integrating short fragments of viral nucleic acid into clusters of regularly interspaced short palindromic repeats (CRISPRs). Here we show how virus-derived sequences contained in CRISPRs are used by CRISPR-associated (Cas) proteins from the host to mediate an antiviral response that counteracts infection. After transcription of the CRISPR, a complex of Cas proteins termed Cascade cleaves a CRISPR RNA precursor in each repeat and retains the cleavage products containing the virus-derived sequence. Assisted by the helicase Cas3, these mature CRISPR RNAs then serve as small guide RNAs that enable Cascade to interfere with virus proliferation. Our results demonstrate that the formation of mature guide RNAs by the CRISPR RNA endonuclease subunit of Cascade is a mechanistic requirement for antiviral defense.

Fig. 1

The composition of the Cascade complex. (A) Schematic diagram of the CRISPR/cas gene cluster of E. coli K12 W3110. Repeats and spacers are indicated by diamonds and rectangles, respectively. A palindrome in the repeat is marked by convergently pointing arrows. Protein family nomenclature is as described in (11, 12). (B) Coomassie blue—stained SDS-polyacrylamide gel of the affinity purified protein complex using either the N-terminal StrepII-tag (S) or C-terminal His-tag (H) of each of the subunits CasB, CasC, CasD, or CasE as bait. Asterisks indicate the 5.5 kD larger double-tagged subunits. Marker sizes in kilodaltons on the left; location of untagged subunits on the right.

Fig. 2

Cascade cleaves CRISPR RNA precursors into small RNAs of ∼57 nucleotides (marked by arrows). (A) Northern analysis of total RNA of WT E. coli K12 (WT), a non-cas gene knockout (Δu, uidA, β-glucuronidase), and Cascade gene knockouts using the single-stranded spacer sequence BG2349 (table S2) as a probe. (B) Northern blot as in (A) of total RNA from E. coli BL21 (DE3) expressing the E. coli K12 pre-crRNA and either the complete or incomplete Cascade complex. (C) Activity assays with purified Cascade using in vitro transcribed α-³²P–uridine triphosphate–labeled pre-crRNA from E. coli K12 (repeat sequence: GAGUUCCCCGCCAGCGGGGAUAAACCG), E. coli UTI89 (repeat sequence: GUUCACUGCCGUACAGGCAGCUUAGAAA), and non-crRNA as substrates. (D) Activity assays as shown in (C) for 15 min with purified MalE-LacZα and MalE-CasE fusion proteins. (E) Northern blot as shown in (B) with Cascade or Cascade-CasE^H20A. (F) Activity assays as shown in (C) for 30 min with purified Cascade or Cascade-CasE^H20A.

Fig. 3

Cleaved crRNAs remain bound by Cascade. (A) Denaturing polyacryl-amide gel showing the crRNA (marked by the arrow) isolated from purified Cascade in the absence and presence of co-expressed pre-crRNA. (B) Secondary structure of pre-crRNA repeats and example sequences of cloned crRNAs indicating the PCS and crRNA handles.

Fig. 4

Engineered CRISPRs confer resistance to λ in the presence of Cascade and Cas3. (A) Effect of the presence of different sets of cas genes on the sensitivity of E. coli to phage λ_vir. Cells were equipped with one of two engineered CRISPRs containing four anti-λ spacers each (fig. S3). The C_1–4 CRISPR produces crRNA complementary to the coding strand and mRNA of λ_vir, and the T_1–4 CRISPR targets only the template strand. The sensitivity of each strain to phage λ_vir is represented as a histogram of the efficiency of plaquing, which is the plaque count ratio of the anti-λ CRISPR to that of the nontargeting control CRISPR. (B) Effect of single anti-λ spacers (fig. S3) on the sensitivity of E. coli to λ_vir. Error bars indicate 1 SD.