Real-time PCR with an internal control for detection of all known human adenovirus serotypes

Abstract

The "gold standard" for the diagnosis of adenovirus (AV) infection is virus culture, which is rather time-consuming. Especially for immunocompromised patients, in whom severe infections with AV have been described, rapid diagnosis is important. Therefore, an internally controlled AV real-time PCR assay detecting all known human AV serotypes was developed. Primers were chosen from the hexon region, which is the most conserved region, and in order to cover all known serotypes, degenerate primers were used. The internal control (IC) DNA contained the same primer binding sites as the AV DNA control but had a shuffled probe region compared to the conserved 24-nucleotide consensus AV hexon probe region (the target). The IC DNA was added to the clinical sample in order to monitor extraction and PCR efficiency. The sensitivity and the linearity of the AV PCR were determined. For testing the specificity of this PCR assay for human AVs, a selection of 51 AV prototype strains and 66 patient samples positive for other DNA viruses were tested. Moreover, a comparison of the AV PCR method described herein with culture and antigen (Ag) detection was performed with a selection of 151 clinical samples. All 51 AV serotypes were detected in the selection of AV prototype strains. Concordant results from culture or Ag detection and PCR were found for 139 (92.1%) of 151 samples. In 12 cases (7.9%), PCR was positive while the culture was negative. In conclusion, a sensitive, internally controlled nonnested AV real-time PCR assay which is able to detect all known AV serotypes with higher sensitivity than a culture or Ag detection method was developed.

FIG. 1.

Standard curve for plasmid DNA containing part of the AV2 hexon gene. Twelve series of 10-fold dilutions of extracted plasmid DNA containing part of the AV2 hexon gene, each with a constant level of 10⁴ copies of IC DNA per dilution, were tested by PCR, resulting in a dynamic range of 5 × 10³ to 5 × 10⁸ copies/ml, with a regression coefficient of 0.991.

FIG. 2.

Alignments of deduced amplicon sequences from serogroups A to F. Alignments were made using Vector NTI. Primer binding sites are indicated in yellow. The probe binding site is indicated in blue. Redundancies in the primer and probe binding sites are marked in red, whereas dashes represent identical nucleotides. Forward primer sequence, CAGGACGCCTCGGRGTAYCTSAG; probe sequence, CCGGTCTGGTGCAATTCGCCCGC; and reverse primer sequence, TTRGGGTGVCACCGAGG (where R is A or G, S is G or C, V is A, C, or G, Y is C or T, and B is T, G, or C.)