New information content in RNA base pairing deduced from quantitative analysis of high-resolution structures

Abstract

Non-canonical base pairs play important roles in organizing the complex three-dimensional folding of RNA. Here, we outline methodology developed both to analyze the spatial patterns of interacting base pairs in known RNA structures and to reconstruct models from the collective experimental information. We focus attention on the structural context and deformability of the seven pairing patterns found in greatest abundance in the helical segments in a set of well-resolved crystal structures, including (i-ii) the canonical A.U and G.C Watson-Crick base pairs, (iii) the G.U wobble pair, (iv) the sheared G.A pair, (v) the A.U Hoogsteen pair, (vi) the U.U wobble pair, and (vii) the G.A Watson-Crick-like pair. The non-canonical pairs stand out from the canonical associations in terms of apparent deformability, spanning a broader range of conformational states as measured by the six rigid-body parameters used to describe the spatial arrangements of the interacting bases, the root-mean-square deviations of the base-pair atoms, and the fluctuations in hydrogen-bonding geometry. The deformabilties, the modes of base-pair deformation, and the preferred sites of occurrence depend on sequence. We also characterize the positioning and overlap of the base pairs with respect to the base pairs that stack immediately above and below them in double-helical fragments. We incorporate the observed positions of the bases, base pairs, and intervening phosphorus atoms in models to predict the effects of the non-canonical interactions on overall helical structure.

Figure 1

Pictorial definitions of the rigid-body parameters used to describe the spatial arrangements of canonical and non-canonical RNA base pairs (left) and sequential base-pair steps (right). Block images of idealized Watson-Crick pairs, generated with 3DNA [15,16] and rendered with Xfig (http://www.xfig.org/), illustrate positive values of the designated parameters. Shading denotes the minor-groove/sugar edge of the bases and base pairs.

Figure 2

Illustration of the relative positions (x_P, y_P, z_P) of the phosphorus atoms (shown as black balls) with respect to the ‘middle’ frame of the GpG·CpC dinucleotide at step 10 in the 2.2 Å crystal complex of r(CGCGUCACACCGGUGAAGUCGC)₂ with lividomycin A (NDB_ID dr0022) [43]. Views looking toward the minor-groove/sugar edge (top) and perpendicular to the mean planes (bottom) of the tandem G·C pairs.

Figure 3

Comparison of hydrogen-bonding interactions, chemical structures (including hydrogen atoms and double bonds), and relative displacement of the bases comprising the predominant base pairs in RNA helical structures. Images depict (a–b) the canonical G·C and A·U Watson-Crick pairs, (c) the wobble G·U pair, (d) the wobble U·U pair, (e) the sheared G·A pair, (e) the Watson-Crick-like G·A pair, and (f) the Hoogsteen A·U pair. Hydrogen bonds in ball-and-stick images on the left are designated by red dashed lines, with the nitrogen and oxygen atoms capable of donating and accepting protons highlighted respectively in blue and red. The double bonds appear as darkened sticks and the glycosyl carbons as gray balls. The superposed stick images on the right illustrate the range of base-pair deformations. Structures generated with 3DNA [15,16] using respectively the rigid-body parameters reported in Table 4 and the observed base-pair parameters of 50 representative examples. Composite images are obtained by superposition of the middle frames of each base pair and arrangement in a ‘top-down’ view perpendicular to the mean base-pair planes. Bases are color-coded by chemical sequence: A (red); U (light blue); G (green): C (yellow).

Figure 4

Images of hydrogen-bonded dimeric fragments illustrating the relative spatial arrangements of tandem G·C Watson-Crick and tandem G·U wobble base pairs and the backbone phosphorus atoms in double-helical RNA structures: (a) GG·CC, GC·GC, CG·CG steps; (b) GG·UU, GU·GU, UG·UG steps. Dimers constructed from the mean base-pair step parameters and (x_P, y_P, z_P) values associated with the given sequences (Table S2 in the Supplementary Materials). Spatial configurations of G·C and G·U pairs are specified by the mean values in Table 4. Bases are depicted by stick figures and phosphorus atoms by filled-in balls in a conventional ‘stacking’ diagram with the numbers denoting the directions of the primary (1→2) and secondary (3→4) strands and the shading the displacement of bases below (light gray) and above (black) the xy plane of each dimer. The x- and y-axes are denoted respectively by the finely dotted vertical and horizontal lines. Major-groove atoms lie on the upper edge and minor/sugar-groove atoms on the lower edge of each base.

Figure 5

Superposed images illustrating the predicted structural response of double-helical RNA to the mean, sequence-dependent spatial arrangements of the constituent dimers. Changes in groove widths and base accessibilities in related structures are evident from the different styles used to represent the chain backbone: (a) the C₁₁G₁₁·C₁₁G₁₁ ‘block’ oligomer and (b) the C₁₀UG₁₁·C₁₀UG₁₁ pseudo ‘block’ oligomer with central pyrimidine-purine steps compared respectively to their, G₁₁C₁₁·G₁₁C₁₁ and G₁₁UC₁₀·G₁₁UC₁₀ counterparts with central purine-pyrimidine steps; and (c) the G22· C₁₀U₂C₁₀ pseudo homooligomer and the G₂₂·C₂₂ homooligomer with tandem G·U and G·C pairs, respecdtively, at the central purine-purine step. The backbones of the pyrimidine-purine and pseudo homooligomer models are depicted by thick ribbons and filled-in balls on phosphorus and those of the overlapping purine-pyrimidine and homooligomer models by thin ribbons. Images are aligned with respect to the central base-pair step of each structure and oriented such that the minor-groove edge of the central dimer faces the viewer. Bases are depicted for the pyrimidine-purine and pseudo homooligomer chains only. Color coding matches that in Figure 3.

Figure 6

Variation of RNA groove widths, measured by the shortest interstrand P···P distances, of the double-helical structures illustrated in Figure 5. Minor-groove widths, denoted by circles, correspond to the distances between P atoms at the designated base-pair steps on the leading strand 2 and those at steps once removed on the opposing strand 2, i.e., steps i on strand 1 and i–2 on strand 2. Major-groove widths, denoted by squares, correspond to the distances between P atoms at steps i on strand 1 and i+5 on strand 2.