Characterization of a thermostable archaeal polynucleotide kinase homologous to human Clp1

Abstract

Clp1 proteins are essential components of the eukaryal mRNA 3' cleavage-polyadenylation machinery. Human Clp1 has an additional function as an RNA-specific 5'-OH polynucleotide kinase, which is implicated in RNA end healing. Yeast Clp1 has no kinase activity, although it binds ATP. Here we report that Clp1-like proteins are extant in archaea. Purification and characterization of Pyrococcus horikoshii Clp1 (PhoClp1) reveals it to be a thermostable 5'-OH polynucleotide kinase optimally active at 55 degrees C to 85 degrees C. PhoClp1 catalyzes transfer of the gamma phosphate from ATP (K (m) 16 microM) to either 5'-OH RNA or DNA ends, although it prefers RNA in a competitive situation. Increasing the monovalent salt concentration to 250 mM suppresses the DNA kinase without affecting RNA phosphorylation, suggesting that RNA is a likely substrate for this enzyme in vivo. Indeed, we show that expression of PhoClp1 in budding yeast can complement a lethal mutation in the 5'-OH RNA kinase module of tRNA ligase. PhoClp1 is a member of the P-loop phosphotransferase superfamily. Alanine mutations at the P-loop lysine (Lys49) and a conserved aspartate (Asp73) inactivate the kinase. Our studies fortify emerging evidence for an enzymatic RNA repair capacity in archaea and provide a new reagent for polynucleotide phosphorylation at high temperatures.

FIGURE 1.

Primary structure similarity between human and archaeal Clp1. The amino acid sequence of P. horikoshii Clp1 (Pho) is aligned to the homologous polypeptide encoded by H. sapiens (Hsa). Gaps in the alignment are indicated by dashes. Positions of amino acid side chain identity or similarity are indicated by dots. The amino acids subjected to alanine substitution (Lys49 and Asp73) are highlighted and indicated by |.

FIGURE 2.

Polynucleotide kinase activity of PhoClp1. (A) PhoClp1 purification. Aliquots (3 μg) of tag-free wild-type PhoClp1 and the K49A and D73A mutants were analyzed by SDS-PAGE. The Coomassie blue stained gel is shown. The positions and sizes (kDa) of marker polypeptides are indicated on the left. The major 41 kDa polypeptide corresponds to tag-free PhoClp1. We did not attempt to identify the 28 kDa polypeptide, although we know it does not correspond to either the cleaved His₁₀Smt3 tag or the Ulp1 protease, which migrate differently during SDS-PAGE. The 28-kDa species was itself generated by Ulp1 cleavage of a larger polypeptide recovered during the first Ni-agarose purification step. Thus, we surmise that the 28-kDa species is probably an N-terminal fragment of Clp1. (B) Kinase activity. Reaction mixtures (10 μL) containing 50 mM Tris-HCl (pH 7.5), 10 mM MgCl₂, 500 μM [γ³²P]ATP, 5 μM 24-mer 5′-OH DNA d(CACTATCGGAATAAGGGCGACACG), and wild-type or mutant PhoClp1 as specified were incubated for 15 min at 55°C. The extent of DNA phosphorylation is plotted as a function of input PhoClp1. Each datum is the average of three separate titration experiments. Error bars denote the standard deviation. (C) Kinetics. Reaction mixtures (70 μL) containing 50 mM Tris-HCl (pH 7.5), 10 mM MgCl₂, 500 μM [γ³²P]ATP, 5 μM 24-mer 5′-OH DNA and either 45, 90, or 180 nM PhoClp1 as specified were incubated at 55°C. Aliquots (10 μL, containing 50 pmol of DNA ends) were withdrawn at the times specified and quenched immediately with EDTA/formamide. (D) ATP titration. Reaction mixtures (10 μL) containing 50 mM Tris-HCl (pH 7.5), 10 mM MgCl₂, 5 μM 24-mer 5′-OH DNA, 0.45 pmol PhoClp1, and [γ³²P]ATP as specified were incubated for 10 min at 55°C. The extent of DNA phosphorylation is plotted as a function of ATP concentration. Each datum is the average of three separate titration experiments. Error bars denote the standard deviation. K _m and k _cat were calculated in Prism by nonlinear regression curve fitting of the experimental data.

FIGURE 3.

PhoClp1 is thermophilic. Reaction mixtures (10 μL) containing 50 mM Tris-HCl at pH 7.5, (DNA kinase) or 50 mM Tris-acetate at pH 6.5, (RNA kinase), 10 mM MgCl₂, 500 μM [γ³²P]ATP, 5 μM 24-mer 5′-OH DNA or 5′-OH RNA as shown, and 0.3 pmol PhoClp1 were incubated for 15 min at the specified temperature. The reactions were initiated by adding PhoClp1 to preheated reaction mixtures. The extents of product formation are plotted as a function of reaction temperature.

FIGURE 4.

RNA is the preferred phosphate acceptor for PhoClp1. Reaction mixtures (10 μL) containing 50 mM Tris-acetate (pH 6.5), 10 mM MgCl₂, 500 μM [γ³²P]ATP, 5 μM each of 24-mer 5′-OH DNA and RNA oligonucleotides (of equivalent sequences depicted in B), and PhoClp1 as specified in B were incubated for 15 min at 55°C. Control reactions contained 10 U of T4 polynucleotide kinase (Pnk) plus either the DNA or RNA substrate. The products were analyzed by denaturing PAGE and visualized by autoradiography (A). The extents of DNA and RNA phosphorylation were quantified by scanning the gel and are plotted as a function of input PhoClp1 in B. Each datum is the average of three separate titration experiments. Error bars denote the standard deviation.

FIGURE 5.

Effect of oligo(A) chain length on PhoClp1 kinase activity. Reaction mixtures (10 μL) containing 50 mM Tris-acetate (pH 6.5), 10 mM MgCl₂, 500 μM [γ³²P]ATP, 5 μM each of 5′-OH oligoadenylates r(A)₃₀, r(A)₂₀, and r(A)₁₀, and increasing amounts of PhoClp1 as specified in B were incubated for 15 min at 55°C. Control reactions contained 10 U of T4 Pnk plus the indicated r(A)_n substrate. The products were analyzed by denaturing PAGE and visualized by autoradiography (A). The extents of DNA and RNA phosphorylation were quantified by scanning the gel and are plotted as a function of input PhoClp1 in B. Each datum is the average of three separate titration experiments. Error bars denote the standard deviation.

FIGURE 6.

Effect of oligo(dA) chain length on PhoClp1 kinase activity. Reaction mixtures (10 μL) containing 50 mM Tris-HCl (pH 7.5), 10 mM MgCl₂, 500 μM [γ³²P]ATP, 5 μM each of 5′-OH oligodeoxyadenylates d(A)₄₀, d(A)₃₀, and d(A)₂₀, and increasing amounts of PhoClp1 as specified in B were incubated for 15 min at 55°C. Control reactions contained 10 U of T4 Pnk plus the indicated r(A)_n substrate. The products were analyzed by denaturing PAGE and visualized by autoradiography (A). The extents of DNA and RNA phosphorylation were quantified by scanning the gel and are plotted as a function of input PhoClp1 in B. Each datum is the average of three separate titration experiments. Error bars denote the standard deviation.

FIGURE 7.

Effect of DNA length. Reaction mixtures (10 μL) containing 50 mM Tris-HCl (pH 7.5), 10 mM MgCl₂, 500 μM [γ³²P]ATP, 5 μM each of 24-mer, 18-mer, and 12-mer 5′-OH DNA oligonucleotides with identical 5′-sequences (depicted at the bottom of A), and increasing amounts of PhoClp1 (as specified in B) were incubated for 15 min at 55°C. Control reactions contained 10 U of T4 Pnk plus the indicated DNA substrate. The products were analyzed by denaturing PAGE and visualized by autoradiography (A). The extents of DNA phosphorylation were quantified by scanning the gel and are plotted as a function of input PhoClp1 in B. Each datum is the average of three separate titration experiments. Error bars denote the standard deviation.

FIGURE 8.

Effect of monovalent salts. (A) Reaction mixtures (10 μL) containing 50 mM Tris-acetate (pH 6.5), 10 mM MgCl₂, 500 μM [γ³²P]ATP, 5 μM 5′-OH d(A)₃₀ or r(A)₃₀ as specified, 0.9 pmol PhoClp1, and either no added salt or 250 mM NaCl as indicated were incubated for 15 min at 55°C. The products were analyzed by denaturing PAGE and visualized by autoradiography. (B) Reaction mixtures (10 μL) containing 50 mM Tris-acetate (pH 6.5), 10 mM MgCl₂, 500 μM [γ³²P]ATP, 5 μM 5′-OH r(A)₃₀, 0.4 pmol PhoClp1, and the indicated concentrations of NH₄Cl, KCl, or NaCl were incubated at 55°C for 15 min. The extents of product formation are plotted as a function of salt concentration. (C) Reaction mixtures (10 μL) containing 50 mM Tris-HCl (pH 7.5), 10 mM MgCl₂, 500 μM [γ³²P]ATP, 5 μM 5′-OH d(A)₃₀, 0.45 pmol PhoClp1, and and the indicated concentrations of NH₄Cl, KCl, or NaCl were incubated at 55°C for 15 min. The extents of product formation are plotted as a function of salt concentration.

FIGURE 9.

Reversal of the polynucleotide kinase reaction. (A) Reaction mixtures (10 μL) containing 50 mM Tris-acetate (pH 5.0), 10 mM MgCl₂, 1 mM ADP, 500 fmol of 5′ ³²P-labeled 24-mer DNA or RNA phosphoryl donor (depicted at the bottom), and 1.8 pmol PhoClp1 (where indicated by +) were incubated for 15 min at 55°C. The products were analyzed by PEI cellulose TLC in 2.5 M LiCl. An autoradiograph of the TLC plate is shown. The position of the unlabeled ATP standard is indicated on the left. (B) Reaction mixtures (10 μL) containing 50 mM Tris-acetate (pH 5.0), 10 mM MgCl₂, 500 fmol 5′ ³²P-labeled 18-mer DNA phosphoryl donor (depicted at the bottom), 1 mM ADP, GDP, CDP, or UDP phosphoryl acceptor, and 1.8 pmol of wild-type of mutant PhoClp1 were incubated for 15 min at 55°C. The products were analyzed by PEI cellulose TLC in 2.5 M LiCl. An autoradiograph of the TLC plate is shown. (C) Reaction mixtures (10 μL) containing 50 mM Tris-acetate (pH 5.0), 10 mM MgCl₂, 1 mM ADP, and 500 fmol 5′ ³²P-labeled 18-mer DNA, and PhoClp1 as specified were incubated for 15 min at 55°C. The extent of ³²P-ATP formation is plotted as a function of input PhoClp1. Each datum is the average of three separate titration experiments. Error bars denote the standard deviation. (D) Reaction mixtures (10 μL) containing 50 mM Tris-acetate (pH 5.0), 10 mM MgCl₂, 500 fmol 5′ ³²P-labeled 18-mer DNA, 0.3 pmol PhoClp1, and ADP as specified were incubated for 13 min at 55°C. The extent of ³²P-ATP formation is plotted as a function of ADP concentration. Each datum is the average of three separate titration experiments. Error bars denote the standard deviation. K _m and k _cat were calculated in Prism by nonlinear regression curve fitting of the experimental data.

FIGURE 10.

PhoClp1 can perform the 5′ end healing step of tRNA splicing in yeast. Yeast trl1Δ p360–TRL1 (URA3 CEN) cells were cotransformed with a CEN TRP1 plasmid bearing AtRNL–S701A plus either: (1) p[CEN HIS3 TRL1-(389–827)] expressing the kinase–CPD domain of yeast tRNA ligase (positive control), (2) an empty 2μ HIS3 vector (negative control), or (3) p[2μ HIS3 PhoCLP1] expressing PhoClp1 under the control of the yeast TPI1 promoter. Trp⁺ His⁺ transformants were selected at 30°C and then streaked on agar medium containing 0.75 mg/mL 5-fluoroorotic acid. The plates were photographed after incubation for 4 d at 30°C.