Controlling transgene expression in subcutaneous implants using a skin lotion containing the apple metabolite phloretin

Abstract

Adjustable control of therapeutic transgenes in engineered cell implants after transdermal and topical delivery of nontoxic trigger molecules would increase convenience, patient compliance, and elimination of hepatic first-pass effect in future therapies. Pseudomonas putida DOT-T1E has evolved the flavonoid-triggered TtgR operon, which controls expression of a multisubstrate-specific efflux pump (TtgABC) to resist plant-derived defense metabolites in its rhizosphere habitat. Taking advantage of the TtgR operon, we have engineered a hybrid P. putida-mammalian genetic unit responsive to phloretin. This flavonoid is contained in apples, and, as such, or as dietary supplement, regularly consumed by humans. The engineered mammalian phloretin-adjustable control element (PEACE) enabled adjustable and reversible transgene expression in different mammalian cell lines and primary cells. Due to the short half-life of phloretin in culture, PEACE could also be used to program expression of difficult-to-produce protein therapeutics during standard bioreactor operation. When formulated in skin lotions and applied to the skin of mice harboring transgenic cell implants, phloretin was able to fine-tune target genes and adjust heterologous protein levels in the bloodstream of treated mice. PEACE-controlled target gene expression could foster advances in biopharmaceutical manufacturing as well as gene- and cell-based therapies.

Fig. 1.

Design and functionality of PEACE. The P. putida DOT-T1E-derived bacterial repressor TtgR was fused to the VP16 transactivation domain of H. simplex virus, and the resulting transactivator TtgA₁ (TtgR-VP16) was cloned under control of the constitutive simian virus 40 promoter (P_SV40) (pMG11). The phloretin-responsive promoter (P_TtgR1; O_TtgR-P_hCMVmin) contains a chimeric TtgR-specific operator sequence (O_TtgR, CAGTATTTACAAACAACCATGAATGTAAGTATATTC; TtgR binding sites in italics), which is located 5′ of a minimal human cytomegalovirus immediate early promoter (P_hCMVmin), and was set to drive expression of the human placental SEAP (pMG10). (A) ON status. TtgA₁ is constitutively expressed and binds to P_TtgR1 in the absence of phloretin; thus, inducing SEAP expression. (B) OFF status. Addition of phloretin releases TtgA₁ from P_TtgR1, which switches SEAP expression off. (C) SEAP expression profiles of CHO-K1 transiently transfected with pMG11 (P_SV40-TtgA₁-pA) and pMG10 (P_TtgR1-SEAP-pA), and cultivated for 48 h in the presence of different phloretin concentrations (0–70 μM).

Fig. 2.

PEACE responsiveness to different flavonoids. (A) Toxicity of flavonoids. CHO-K1 were transiently transfected with pSEAP2-Control, cultivated in medium supplemented with different flavonoids (0, 25, and 50 μM) SEAP levels were scored after 48 h. (B) CHO-K1 cells transiently expressing all PEACE components (pMG10 and pMG11) were cultivated in the presence of different flavonoids and SEAP expression was profiled after 48 h.

Fig. 3.

Design and characterization of the stable CHO-PEACE₈ cell line transgenic for phloretin-responsive SEAP expression. (A) Dose-response profile of CHO-PEACE₈. (B) SEAP expression kinetics of CHO-PEACE₈ cultivated for 72 h in the presence and absence of 50 μM phloretin. (C) Reversibility of CHO-PEACE₈-based SEAP production; 2 × 10⁵ CHO-PEACE₈ were cultivated for 144 h in the presence or absence of 50 μM phloretin. Every 48 h, the cell density was readjusted to 2 × 10⁵, and the phloretin status of the culture was reversed.

Fig. 4.

Automatically programmed product gene expression in bioreactors using well-defined phloretin degradation profiles. The 2 × 10³ cells/mL CHO-PEACE₈ were cultivated in a bioreactor containing 1-L culture medium supplemented with either 60, 80, or 100 μM phloretin, and SEAP production was profiled for 211 h. Owing to a defined phloretin degradation profile in culture and a precise induction threshold of 40 μM phloretin, the onset of SEAP production can be programmed to occur at a very precise point in time by defining the cell density and the phloretin concentration at production start.

Fig. 5.

PEACE-controlled transgene expression in mice. (A) Microencapsulated CHO-PEACE₈ were implanted s.c. into female OF1 mice (2 × 10⁶ cells per mouse); 200 μL of a cream containing different amounts of phloretin (0, 5.25, 10.5, 21, and 42 mg) was applied to a shaved skin area near the implant site. SEAP serum levels were quantified 72 h postimplantation. (B) SEAP expression profiles of the microencapsulated CHO-PEACE₈ implant batch cultivated in vitro for 72 h at different phloretin concentrations.