Copy number variations and cancer

Abstract

DNA copy number variations (CNVs) are an important component of genetic variation, affecting a greater fraction of the genome than single nucleotide polymorphisms (SNPs). The advent of high-resolution SNP arrays has made it possible to identify CNVs. Characterization of widespread constitutional (germline) CNVs has provided insight into their role in susceptibility to a wide spectrum of diseases, and somatic CNVs can be used to identify regions of the genome involved in disease phenotypes. The role of CNVs as risk factors for cancer is currently underappreciated. However, the genomic instability and structural dynamism that characterize cancer cells would seem to make this form of genetic variation particularly intriguing to study in cancer. Here, we provide a detailed overview of the current understanding of the CNVs that arise in the human genome and explore the emerging literature that reveals associations of both constitutional and somatic CNVs with a wide variety of human cancers.

Figure 1

Distribution of common cancer CNVs in the human genome. The chromosomes containing common cancer CNVs in the human genome are shown, with centromeric regions in red (using data from [19]) and Giemsa banding patterns in white, grey or black. Loci are in green if they were found to contain a cancer-related gene that is overlapped or encompassed by a CNV (as found by [18]).

Figure 2

Cancer CNV breakpoint mapping. We mapped a 1.1 kb deletion in the mitochondrial tumor suppressor gene, MTUS1, to base-pair resolution. The affected portion of the gene is shown, including an exon (blue) that is deleted in the presence of the CNV. Two 41 bp repeats (with sequence AAATAAGAACCAAGTCCAAATACATCTTTGGAATGAAAGAG) were found at the breakpoints (red), while the sequence of the junction fragment is shown in the chromatogram.

Figure 3

Proposed model for CNVs in tumorigenesis. A model of copy-number-variable DNA regions in patients with sporadic (top) or inherited (bottom) cancer. We propose that healthy people maintain a similar low number of CNVs in their genomes (left; black blocks indicate inherited CNVs), whereas those at risk of developing early onset cancer have an excess of CNVs and a greater overall genomic burden of copy-number-variable DNA (middle; red blocks indicate somatically acquired CNVs). As a tumor grows, it acquires more copy-number-variable regions, including tumor-specific regions (blue). Reproduced with permission from [18], copyright (2008) National Academy of Sciences, USA.