Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
. 2010 Apr;37(4):1987-91.
doi: 10.1007/s11033-009-9647-7. Epub 2009 Aug 5.

A retro-lentiviral system for doxycycline-inducible gene expression and gene knockdown in cells with limited proliferative capacity

Affiliations

A retro-lentiviral system for doxycycline-inducible gene expression and gene knockdown in cells with limited proliferative capacity

Mikhail F Alexeyev et al. Mol Biol Rep. 2010 Apr.

Abstract

Currently, there is no reliable system for regulated gene expression and regulated gene knockdown in cells with finite lifespan. In this manuscript, we describe a vector system, consisting of a retrovirus for the delivery of rtTA, and a lentivirus for the delivery of either a transgene or a miR-shRNA for the modification of primary cells. Primary rat pulmonary microvascular endothelial cells (PMVEC) modified by these vectors for the inducible expression of Gaussia luciferase or DsRed Express demonstrated greater than 100-fold induction of the transgene expression with doxycycline. The system works reliably in both sequential and simultaneous infection modes, with about 95% of the sells selected with two antibiotics being inducible in each mode. The lentiviral vector for gene knockdown allows for the direct cloning of shRNA oligos using alpha-complementation, and for the monitoring of induction of RNA interference with fluorescent reporter, mCherry. The gene knockdown vector was validated by knocking down beta-actin expression in PMVECs, with two of the four constructs showing 59 and 75% knockdown, respectively, compared to uninduced controls. The vectors described here were successfully used for the modification of various primary and established cell lines for regulated gene expression and regulated knockdown.

PubMed Disclaimer

Figures

Fig. 1
Fig. 1
Vector maps. Abbreviations: 5’ and 3’ mir, 5’ and 3’ flanking sequences derived from the murine mir-155 micro-RNA gene; Bsr, blasticidin resistance gene; DRE, DsRed express; EGFP, enhanced green fluorescent protein; Gluc, (secreted) Gaussia luciferase; HIV RRE, human immunodeficiency virus rev response element; IRES EMV, encephalomyelocarditis virus internal ribosome entry site; lacZα, gene encoding the alpha-fragment of E. coli β-galactosidase gene; LTR, retro/lentiviral long terminal repeat; PAC, puromycin resistance gene; PL, polylinker. Unique sites 5’-EcoRI, XhoI, ApaI, MluI, NotI, XbaI, SpeI, BamHI, SmaI, PstI-3’; PPGK, phosphoglycerate kinase promoter; PCMV, CMV promoter; PSV40, SV40 promoter; PTet, doxycycline-regulated promoter; rtTA, reverse tetracycline-controlled transactivator protein; wPRE, woodchuck hepatitis virus posttranscriptional regulatory element.
Fig. 2
Fig. 2
Luciferase inducibility of PMVECs. PMVECs were infected with retrovirus 2640 or 2641, selected for 5 days with 30 μg/ml blasticidin, infected with lentivirus #2706, and induced with 3 μg/ml of doxycycline for 24h. Luciferase assays were performed as described in Materials and Methods. Luciferase activity is expressed in relative light units. The data are mean ± SEM (n=4).
Fig. 3
Fig. 3
Inducibility of DRE and percent responsive PMVECs as reported by FACS. A, inducibility. B, percent responsive cells. PMVECs were simultaneously infected with retrovirus #2641 and lentivirus #2706 overnight, allowed to recover for 24h in DMEM, and selected with 30 μg/ml blasticidin for 2 days followed by selection with 30 μg/ml blasticidin plus 5 μg/ml puromycin for 1 day and finally with blasticidin and puromycin ± 3 μg/ml of doxycycline for 2 days. At the end of experiment, cells were collected by trypsinization and subjected to FACS analysis. The data are mean ± SEM (n=3).
Fig. 3
Fig. 3
Inducibility of DRE and percent responsive PMVECs as reported by FACS. A, inducibility. B, percent responsive cells. PMVECs were simultaneously infected with retrovirus #2641 and lentivirus #2706 overnight, allowed to recover for 24h in DMEM, and selected with 30 μg/ml blasticidin for 2 days followed by selection with 30 μg/ml blasticidin plus 5 μg/ml puromycin for 1 day and finally with blasticidin and puromycin ± 3 μg/ml of doxycycline for 2 days. At the end of experiment, cells were collected by trypsinization and subjected to FACS analysis. The data are mean ± SEM (n=3).
Fig. 4
Fig. 4
Knockdown of β-actin in PMVECs. For knockdown experiments, four lentiviral constructs were generated, which targeted four regions of the rat β-actin mRNA (target sequences: #1= gaagatttggcaccacacttt, #2=caggctgtgttgtccctgtat, #3= gaaatcgtgcgtgacattaaa, and 4= cctgacagactacctcatgaa). PMVECs were infected first with #2641 (selection for blasticidin resistance, 30 ug/ml, 5 days), and then with one of the knockdown constructs (selected for 3 days with with 5 ug/ml of puromycin). Cells were either induced (+) or not (−) with 3 μg/ml of doxycycline (Dox). Western Blotting was performed as described in Materials and Methods, chemiluminescense was documented with Fujifilm LAS-1000 cooled CCD camera, and analyzed with MultiGauge 3.0 program.

References

    1. Pohjoismaki Jl, Wanrooij S, Hyvarinen Ak, et al. Alterations to the expression level of mitochondrial transcription factor A, TFAM, modify the mode of mitochondrial DNA replication in cultured human cells. Nucleic acids research. 2006;34(20):5815–5828. doi:gkl703 [pii] 10.1093/nar/gkl703. - PMC - PubMed
    1. Pastukh V, Shokolenko I, Wang B, et al. Human mitochondrial transcription factor A possesses multiple subcellular targeting signals. FEBS J. 2007;274(24):6488–6499. doi:EJB6167 [pii] 10.1111/j.1742-4658.2007.06167.x. - PubMed
    1. Sambrook J, Russel Dw. A laboratory manual. Cold Spring Harbor Laboratory Press; New York: 2001. Molecular Cloning.
    1. King J, Hamil T, Creighton J, et al. Structural and functional characteristics of lung macro- and microvascular endothelial cell phenotypes. Microvasc Res. 2004;67(2):139–151. doi:10.1016/j.mvr.2003.11.006 S002628620300116X [pii] - PubMed
    1. Rappa G, Anzanello F, Alexeyev M, et al. Gamma-glutamylcysteine synthetase-based selection strategy for gene therapy of chronic granulomatous disease and graft-vs.-host disease. Eur J Haematol. 2007;78(5):440–448. doi:EJH833 [pii] 10.1111/j.1600-0609.2007.00833.x. - PubMed

Publication types

MeSH terms