Effect of calcium-modulating cyclophilin ligand on human immunodeficiency virus type 1 particle release and cell surface expression of tetherin

Abstract

The human immunodeficiency virus type 1 (HIV-1) accessory protein Vpu enhances virus particle release by counteracting a host factor that retains virions at the surfaces of infected cells. It was recently demonstrated that cellular protein BST-2/CD317/Tetherin restricts HIV-1 release in a Vpu-dependent manner. Calcium-modulating cyclophilin ligand (CAML) was also proposed to be involved in this process. We investigated whether CAML is involved in cell surface expression of Tetherin. Here, we show that CAML overexpression in permissive Cos-7 cells or CAML depletion in restrictive HeLa cells has no effect on HIV-1 release or on Tetherin surface expression, indicating that CAML is not required for Tetherin-mediated restriction of HIV-1 release.

FIG. 1.

Effect of CAML overexpression on HIV-1 particle release from permissive Cos-7 cells. (A and B) Cos-7 cells were seeded onto six-well plates and transfected using Lipofectamine 2000 according to the recommendations of the manufacturer (Invitrogen). Triplicate wells received fixed amounts of HxBH10vpu_wt (wt) or HxBH10vpu− (−) proviral DNA (2 μg) and pCMV-HA-hCAML (1 μg), along with the pCMV-HA empty vector to obtain the same final amounts of total DNA. (A) Western blot for Cos-7 cells transfected with the proviral DNA plasmid HxBH10vpu− (lanes 2, 4, and 7) or HxBH10vpu_wt (lanes 3, 5, and 8) or mock transfected (m; lanes 1 and 6). Samples from lanes 4 and 5 were treated with 10,000 U/ml of IFN-α, while samples from lanes 6 to 8 were cotransfected with the HA-tagged hCAML-expressing plasmid. Cells and supernatants containing viral particles were harvested 48 h posttransfection, and lysates were analyzed by Western blotting to detect steady-state levels of target proteins. Cell lysates were analyzed to detect HA-tagged CAML (by using anti-HA antibodies), as well as Gag products, Vpu, and cellular actin by using specific antibodies. Virus lysates were analyzed for the presence of p24 by using specific antibodies. (B) Quantification of virus particle release efficiency. (Top) Densitometric quantification of HIV-1 particle release efficiency in the presence of hCAML or upon IFN-α-treatment was performed by determining the ratio between the virion-associated Gag signal (corresponding to mature p24) and all cell-associated Gag signals (corresponding to p24/p25 and precursors p55 and p41) by Western blotting. Bands corresponding to all Gag products in cells and virus particles were scanned by laser densitometry and quantified using ImageQuant 5.0. (Bottom) Levels of released infectious virus were determined using HeLa-TZM indicator cells. HeLa-TZM indicator cells (AIDS Research and Reference Program, NIH) were inoculated with an aliquot of virus-containing supernatant. After 48 h, cells were lysed and luciferase activity was evaluated using the Promega luciferase assay system. For both top and bottom panels, the release efficiency of HxBH10vpu_wt was arbitrarily set at 100%. Error bars indicate the standard deviations of the means of results from two independent experiments. (C) Effect of increasing amounts of HA-hCAML on HIV-1 particle release. Cos-7 cells were seeded onto six-well plates and transfected as described in the legend to panel A. The cells received fixed amounts of HxBH10vpu_wt or HxBH10vpu− proviral DNA (2 μg) and increasing amounts of pCMV-HA-hCAML (from 2 to 8 μg), along with the pCMV-HA empty vector to obtain the same final amounts of total DNA. Cells and virus-containing supernatants were harvested 48 h posttransfection, and lysates were analyzed by Western blotting to detect Gag products and Vpu by using specific antibodies as indicated. Shown is a Western blot for Cos-7 cells transfected with the proviral DNA plasmid HxBH10vpu− (lanes 2, 4, 6, 8, and 10) or HxBH10vpu_wt (lanes 1, 3, 5, 7, and 9). Samples from lanes 3 to 10 were cotransfected with the HA-tagged hCAML-expressing plasmid.

FIG. 2.

Effect of CAML overexpression on Tetherin expression at the surfaces of permissive Cos-7 cells. (A to C) Cos-7 cells were mock transfected or transfected with the HxBH10vpu_wt or HxBH10vpu− proviral construct. Forty-eight hours posttransfection, cell surface expression of Tetherin was evaluated after surface staining using anti-Tetherin antibodies, followed by flow cytometry. Tetherin antiserum was produced in rabbits by using a glutathione S-transferase-Tetherin fusion protein composed of Tetherin amino acids 40 to 181, produced in bacteria, thus generating a polyclonal antibody against the extracellular portion of Tetherin. In each panel, the gray-filled histogram represents results for mock-transfected cells stained with the preimmune rabbit serum (unstained control) while the other histograms represent results for cells stained with anti-Tetherin polyclonal rabbit serum. The histogram with a solid line represents data for mock-transfected cells, the histogram with a dotted line corresponds to mock-transfected cells treated with 10,000 U/ml of IFN-α, and the dashed-line histogram represents data for cells expressing hCAML. Mean fluorescence intensity (MFI) values after subtraction of the value for the unstained control are indicated for each sample. Stained cells were analyzed on a FACSCalibur instrument (BD Biosciences Immunocytometry Systems), and data analysis was performed by using CellQuest Pro (BD Biosciences) and FlowJo software version 7.25 (Tree Star). agm, African green monkey cells.

FIG. 3.

Effect of CAML depletion on HIV-1 particle release and surface expression of Tetherin in nonpermissive HeLa cells. (A) HeLa cells were transfected with nontargeting siRNA (siGENOME control siRNA [catalog no. D-001210-02-20; Dharmacon]; lanes 1 to 3) or specific siRNA against CAML (siGENOME SMART pool [catalog no. M-011601-01; Dharmacon]; lanes 4 to 6). Subsequently, cells were mock transfected (M; lanes 1 and 4) or transfected with the proviral plasmid HxBH10vpu_wt (wt; lanes 2 and 5) or HxBH10vpu− (−; lanes 3 and 6). Cells and supernatants containing viral particles were harvested 24 h posttransfection, and lysates were analyzed by Western blotting. Cell lysates were analyzed to detect Gag products, Vpu, and β-actin by using specific antibodies. Virus lysates were analyzed for the presence of p24 by using anti-p24 antibodies. Depletion of CAML mRNA was confirmed by RT-PCR using CAML mRNA-specific primers (forward primer, 5′ GGTGATTCAGTCAGTACAGG 3′; reverse primer, 5′ CTGACTCCAAGAGCAAGAAG 3′); as a control, actin mRNA levels were analyzed by RT-PCR using actin-specific primers (forward primer, 5′ACTCCTGCTTGCTGATCCAC 3′; reverse primer, 5′ TGGCTACAGCTTCACCACC 3′). (B) Quantification of virus particle release efficiency. (Top) Densitometric quantification of HIV-1 particle release efficiency after endogenous hCAML depletion. Virus release efficiency was evaluated as described in the legend to Fig. 1B. The virion-associated p24 signals were evaluated using longer blot exposure times to reveal the bands associated with HxBH10vpu−. (Bottom) The levels of released infectious virus were evaluated using HeLa-TZM indicator cells as described in the legend to Fig. 1B. For both panels, the release efficiency of HxBH10vpu_wt was arbitrarily set at 100%. Error bars indicate the standard deviations of the means of results from two independent experiments. (C) Tetherin cell surface expression was measured by flow cytometry as described in the legend to Fig. 2. The levels of surface expression of Tetherin by HeLa cells transfected with nontargeting siRNA (solid-line histogram) were compared to the levels of expression by HeLa cells transfected with specific siRNA against CAML (dashed-line histogram). As a negative control, unstained HeLa cells transfected with nontargeting siRNA were included (gray-filled histogram). Mean fluorescence intensity (MFI) values are indicated for each sample.

FIG. 4.

Effect of Tetherin depletion on HIV-1 particle release from nonpermissive HeLa cells. (A) HeLa cells were transfected with nontargeting siRNA (siGENOME control siRNA [catalog no. D-001210-02-20; Dharmacon]; lanes 1 to 3) or specific siRNA against Tetherin (ON-TARGET plus SMART pool [catalog no. L-011817-00; Dharmacon]; lanes 4 to 6). Subsequently, cells were mock-transfected (M; lanes 1 and 4) or transfected with the proviral plasmid HxBH10vpu− (−; lanes 2 and 5) or HxBH10vpu_wt (wt; lanes 3 and 6) as indicated. Cells and supernatants containing viral particles were harvested 24 h posttransfection, and lysates were analyzed by Western blotting. Cell lysates were analyzed to detect Gag products and endogenous cellular Tetherin by using anti-p24 antibodies (the asterisk denotes a nonspecific band used as an internal loading control). Virus lysates were analyzed for the presence of p24 by using specific antibodies. (B) Densitometric quantification of HIV-1 release efficiency after endogenous Tetherin depletion. HIV-1 particle release efficiency was evaluated as described in the legend to Fig. 1B. The release efficiency of HxBH10vpu_wt was arbitrarily set at 100%. Error bars indicate the standard deviations of the means of results from two independent experiments.