Epigenetic alterations in a murine model for chronic lymphocytic leukemia

Abstract

Early stages in the development of chronic lymphocytic leukemia (CLL) have not been explored mainly due to the inability to study normal B-cells en route to transformation. In order to determine such early events of leukemogenesis, we have used a well established mouse model for CLL. Over-expression of human TCL1, a known CLL oncogene in murine B-cells leads to the development of mature CD19+/CD5+/IgM+ clonal leukemia with a disease phenotype similar to that seen in human CLL. Herein, we review our recent study using this TCL1-driven mouse model for CLL and corresponding human CLL samples in a cross-species epigenomics approach to address the timing and relevance of epigenetic events occurring during leukemogenesis. We demonstrated that the mouse model recapitulates the epigenetic events that have been reported for human CLL, affirming the power and validity of this mouse model to study early epigenetic events in cancer progression. Epigenetic alterations are detected as early as three months after birth, far before disease manifests at about 11 months of age. These mice undergo NFkappaB repressor complex mediated inactivation of the transcription factor Foxd3, whose targets become aberrantly methylated and silenced in mouse and human CLL. Overall, our data suggest the accumulated epigenetic alterations during CLL pathogenesis as a consequence of gene silencing through TCL1 and NFkappaB repressor complex, suggesting the relevance for NFkappaB as a therapeutic target in CLL.

Figure 1. Elevated global hypomethylation of repetitive sequences in CLL

Hypomethylation profiles on mouse and human CLL samples from different stages were studied by Southern blotting as previous described. Genomic DNAs of spleen cells from wild type and Eµ-TCL1 mice at indicated time points, or Eµ-TCL1 mice with symptomatic disease (n=5), were digested with MspI (M) or HpaII (H) restriction enzymes. The blots were hybridized with intracisternal A particle probe (IAP) (Top) or centromeric repeat sequences (CMR) (Middle). For CLL patient samples, the analysis was done using human LINE1 probes on the peripheral blood B cells from patients required no treatment (early CLL) or that underwent treatment (advanced CLL) (Bottom). MspI digested DNA was used as control. Undigested product of HpaII digestion represents methylated DNA, while only unmethylated DNA is HpaII digestible. Mouse IAP, CMS and human LINE1 probes were prepared by PCR amplification using forward (F) and reverse (R) primers: IAP-F: 5’CGTCATTGTTCAGAGCCAGA3’, IAP-R: 5’TCCCGGAAACTTTTGTTCAC3’; CMS-F: 5’GATAAAAACCTACACTGTAG3’, CMS-R: 5’GTTTCTAATTGTAACTCATTG3’; LINE1-F: CGGGTGATTTCTGCATTTCC and LINE1-R: GACATTTAAGTCTGCAGAGG.

Figure 2. Decreased miR29s and increased DNMTs in Eµ-TCL1 mice

Expression of miR29s by TaqMan PCR was done on TCL1 mouse spleen B cells. Each bar represents the average results from three mice at the indicated age. Results were normalized by the data obtained from untransformed B cells from 1 month old mice. Standard deviation was calculated by using mean ± SEM of respective data. Two tail unequal variant student T test was applied, star represents significant results with P value less than 0.05.

Figure 3. Negative regulated FOXD3 by TCL1 in CLL cells

(a) Luciferase assay was done on WAC3CD5 cell line transfected with 1µg pCMV-TCL1 (gray bar) or control vector (black bar). The diagram shows human FOXD3 5’ promoter region cloned into pGL3 vector for the analysis. Results from each cell line transfected with pGL3-basic vector (NC) were set as 1. Each bar represents the average result from the triplicate experiments using mean ± SEM of respective data. (b) FOXD3 and TCL1 expression were analyzed in two normal B cell samples and 6 CLL B cell samples from patients with different diagnosis. The error bars using mean ± SEM of respective data of triplicate experiments.