Plasmodium berghei crystalloids contain multiple LCCL proteins
- PMID: 19932717
- PMCID: PMC2816727
- DOI: 10.1016/j.molbiopara.2009.11.008
Plasmodium berghei crystalloids contain multiple LCCL proteins
Abstract
Malaria crystalloids are unique organelles of unknown function that are present only in the mosquito-specific ookinete and early oocyst stages of the parasite. Recently, crystalloid formation in Plasmodium berghei was linked to the parasite protein PbSR, a member of the Plasmodium LCCL protein family composed of six modular multidomain proteins involved in sporozoite development and infectivity. Here, we show by fluorescent protein tagging that two other LCCL protein family members are targeted to the crystalloids in a similar way to PbSR. These results extend the similarities between the LCCL proteins, and provide strong supporting evidence for the hypothesis that members of this protein family work in concert and are involved in a similar molecular process.
Figures

Primer sequences: P1
(ACGAAGTTATCAGTCGACATGAGTCATTACTAGACATAATTACAAGTGAA); P2
(ATGAGGGCCCCTAAGCTTTCAGTAATTCCATGAGTTACTTTGC); P3
(ACGAAGTTATCAGTCGAGGTACCTAGCGGAAACAACAATGTTC); P4
(ATGAGGGCCCCTAAGCTATTTTTAATAATTTGTATCGAAAGTATAGTTG); P5
(CCTTCAATTTCGACATATAATGGATTAAAATTTTAGTTCGGT); P6
(GCGGCCGCTCTAGCATAGGATTAGAAATACAGTAATAGCAATTTTG); P7
(CATCTATACATGCAGGCG); P8
(GTGCCCATTAACATCACC); P9
(ACAAAGAATTCATGGTTGGTTCGCTAAACT); P10 (CCTCAAGATAGTTACGAATTTAAC).

Similar articles
-
PbSR is synthesized in macrogametocytes and involved in formation of the malaria crystalloids.Mol Microbiol. 2008 Jun;68(6):1560-9. doi: 10.1111/j.1365-2958.2008.06254.x. Epub 2008 Apr 29. Mol Microbiol. 2008. PMID: 18452513 Free PMC article.
-
Biogenesis of the crystalloid organelle in Plasmodium involves microtubule-dependent vesicle transport and assembly.Int J Parasitol. 2015 Jul;45(8):537-47. doi: 10.1016/j.ijpara.2015.03.002. Epub 2015 Apr 18. Int J Parasitol. 2015. PMID: 25900212 Free PMC article.
-
Translational repression controls temporal expression of the Plasmodium berghei LCCL protein complex.Mol Biochem Parasitol. 2013 May;189(1-2):38-42. doi: 10.1016/j.molbiopara.2013.04.006. Epub 2013 May 15. Mol Biochem Parasitol. 2013. PMID: 23684590 Free PMC article.
-
Crystalloids: Fascinating Parasite Organelles Essential for Malaria Transmission.Trends Parasitol. 2021 Jul;37(7):581-584. doi: 10.1016/j.pt.2021.04.002. Epub 2021 Apr 30. Trends Parasitol. 2021. PMID: 33941493 Review.
-
The Multiple Roles of LCCL Domain-Containing Proteins for Malaria Parasite Transmission.Microorganisms. 2024 Jan 29;12(2):279. doi: 10.3390/microorganisms12020279. Microorganisms. 2024. PMID: 38399683 Free PMC article. Review.
Cited by
-
Identification of CCp5 and FNPA as Novel Non-canonical Members of the CCp Protein Family in Babesia bovis.Front Vet Sci. 2022 Feb 15;9:833183. doi: 10.3389/fvets.2022.833183. eCollection 2022. Front Vet Sci. 2022. PMID: 35242841 Free PMC article.
-
APEX-based proximity labeling in Plasmodium identifies a membrane protein with dual functions during mosquito infection.PLoS Pathog. 2024 Dec 18;20(12):e1012788. doi: 10.1371/journal.ppat.1012788. eCollection 2024 Dec. PLoS Pathog. 2024. PMID: 39693377 Free PMC article.
-
Pleiotropic Roles for the Plasmodium berghei RNA Binding Protein UIS12 in Transmission and Oocyst Maturation.Front Cell Infect Microbiol. 2021 Mar 5;11:624945. doi: 10.3389/fcimb.2021.624945. eCollection 2021. Front Cell Infect Microbiol. 2021. PMID: 33747980 Free PMC article.
-
Family members stick together: multi-protein complexes of malaria parasites.Med Microbiol Immunol. 2010 Aug;199(3):209-26. doi: 10.1007/s00430-010-0157-y. Epub 2010 Apr 24. Med Microbiol Immunol. 2010. PMID: 20419315 Review.
-
Genome-wide RIP-Chip analysis of translational repressor-bound mRNAs in the Plasmodium gametocyte.Genome Biol. 2014 Nov 3;15(11):493. doi: 10.1186/s13059-014-0493-0. Genome Biol. 2014. PMID: 25418785 Free PMC article.
References
-
- Trexler M., Banyai L., Patthy L. Eur J Biochem. 2000;267(18):5751–5757. - PubMed
-
- Lasonder E., Ishihama Y., Andersen J.S. Nature. 2002;419(6906):537–542. - PubMed
-
- Dessens J.T., Sinden R.E., Claudianos C. Trends Parasitol. 2004;20(3):102–108. - PubMed
-
- Claudianos C., Dessens J.T., Trueman H.E. Mol Microbiol. 2002;45(6):1473–1484. - PubMed
Publication types
MeSH terms
Substances
Grants and funding
LinkOut - more resources
Full Text Sources
Molecular Biology Databases