Dependence of aptamer activity on opposed terminal extensions: improvement of light-regulation efficiency

Abstract

Aptamers that can be regulated with light allow precise control of protein activity in space and time and hence of biological function in general. In a previous study, we showed that the activity of the thrombin-binding aptamer HD1 can be turned off by irradiation using a light activatable 'caged' intramolecular antisense-domain. However, the activity of the presented aptamer in its ON state was only mediocre. Here we studied the nature of this loss in activity in detail and found that switching from 5'- to 3'-extensions affords aptamers that are even more potent than the unmodified HD1. In particular we arrived at derivatives that are now more active than the aptamer NU172 that is currently in phase 2 clinical trials as an anticoagulant. As a result, we present light-regulatable aptamers with a superior activity in their ON state and an almost digital ON/OFF behavior upon irradiation.

Figure 1.

(a) Cartoon representation of the antiparallel quadruplex structure of the thrombin-binding aptamer HD1 and of HD1 bound to thrombin (PDB code: 1HAO). Thrombin is shown as surface with negatively charged areas colored in red and positively in blue. (b) Top: Cartoon representation of the light-induced inactivation of HD1. Middle: The aptamers 1–3 with designed intramolecular antisense residues (underlined) have been part of a previous study in which we already showed that it is possible to turn the activity of HD1 OFF by irradiation with light (18). Shown are also the residues dC^NPE and dA^NPE (bottom). The former has been introduced in our previous study (18) while the latter is introduced here. Both residues have photolabile NPE groups (o-nitrophenylethyl) that keep them from forming normal nucleobase interactions until irradiation and can thus mask nucleotide activity that can be restored with control of space and time.

Figure 2.

Results of coagulation assays with the listed aptamers without or with (hν) irradiation. Clotting times have been normalized toward the one of HD1. A second—reciprocal—scale is given that shows how much thrombin remained active. The sequence of the aptamer NU172 (used in this study for comparison reasons) is CGCCTAGGTTGGGTAGGGTGGTGGCG (20). (ab = abasic site, C3 = n-propyl spacer nucleotide, TriEG = triethylene glycol nucleotide, TetEG = tetraethylene glycol nucleotide).

Figure 3.

Synthesis of the caged phosphoramidite for the introduction of a dA^NPE residue into an oligonucleotide with standard solid phase synthesis technology (TBDMS = tert. butyldimethylsilyl, TPS = triisopropylbenzenesulphonyl, DMAP = N,N-dimethylaminopyridine, DIEA = Hünig’s Base, TBAF = tetrabutylammonium fluoride).

Figure 4.

Results of coagulation assays with the listed aptamers without or with (hν) irradiation. Clotting times have been normalized toward the one of HD1. A second—reciprocal—scale is given that shows how much thrombin remained active.

Figure 5.

CD spectra of the listed aptamers (ab = abasic site, C3 = n-propyl spacer nucleotide, TriEG = triethylene glycol nucleotide, TetEG = tetraethylene glycol nucleotide).

Figure 6.

CD spectra of the listed aptamers without or with (hν) irradiation (ab = abasic site, C3 = n-propyl spacer nucleotide, TriEG = triethylene glycol nucleotide, TetEG = tetraethylene glycol nucleotide).