PcaO positively regulates pcaHG of the beta-ketoadipate pathway in Corynebacterium glutamicum

Abstract

We identified a new regulator, PcaO, which is involved in regulation of the protocatechuate (PCA) branch of the beta-ketoadipate pathway in Corynebacterium glutamicum. PcaO is an atypical large ATP-binding LuxR family (LAL)-type regulator and does not have a Walker A motif. A mutant of C. glutamicum in which pcaO was disrupted (RES167DeltapcaO) was unable to grow on PCA, and growth on PCA was restored by complementation with pcaO. Both an enzymatic assay of PCA 3,4-dioxygenase activity (encoded by pcaHG) and transcriptional analysis of pcaHG by reverse transcription-PCR revealed that PcaO positively regulated pcaHG. A promoter-LacZ transcriptional fusion assay suggested that PcaO interacted with the sequence upstream of pcaHG. Electrophoretic mobility shift assay (EMSA) analysis indicated that an imperfect palindromic sequence ((-78)AACCCCTGACCTTCGGGGTT(-59)) that was located upstream of the -35 region of the pcaHG promoter was essential for PcaO regulation. DNase I footprinting showed that this imperfect palindrome was protected from DNase I digestion. Site-directed mutation and EMSA tests revealed that this palindrome sequence was essential for PcaO binding to the DNA fragment. In vitro EMSA results showed that ATP weakened the binding between PcaO and its target sequence but ADP strengthened this binding, while the effect of protocatechuate on PcaO binding was dependent on the protocatechuate concentration.

FIG. 1.

Schematic diagram of the protocatechuate (PCA) branch of the β-ketoadipate pathway (A) and genetic organization of the genes involved in C. glutamicum and other bacteria (B). The complete designations of all regulator genes are indicated, and the pcaO gene is indicated by shading. Other pca genes are indicated by capital letters. PcaHG, PCA 3,4-dioxygenase; PcaB, β-carboxy-cis,cis-muconate cycloimerase; PcaC, γ-carboxymuconolactone decarboxylase; PcaD, β-ketoadipate enol-lactone hydrolase; PcaIJ, β-ketoadipate succinyl-coenzyme A transferase; PcaF, β-ketoadipate coenzyme A thiolase; TCA, tricarboxylic acid cycle.

FIG. 2.

Growth of C. glutamicum strains in mineral salts medium with 2 mM protocatechuate as the sole carbon and energy source. ▪, RES167; •, RES167ΔpcaO; ▴, RES167ΔpcaO/pXMJ19-PcaO.

FIG. 3.

Determination of the transcription start site (TSS) of pcaHG (A) and diagram of intergenic sequences between pcaHG and ncgl2316 (B). In panel A, the transcription start base C is indicated by a triangle. Primer extension was performed using DNase I-treated RNA (10 μg) isolated from cells cultivated in mineral salts medium containing protocatechuate. The labeled primer (2315PE) was complementary to a sequence 96 bp downstream of the translation start codon of pcaH. The sequencing products of PpcaHG obtained with the labeled primer (lanes G, A, C, and T) were simultaneously electrophoresed with the reverse transcribed products. In panel B, the palindromic sequences (Rep1, Rep2, Rep3, and Rep4), putative ribosome binding site (RBS), and putative −10 and −35 regions are indicated.

FIG. 4.

Determination of pcaHGBC promoter activity in C. glutamicum RES167 and RES167ΔpcaO, as reflected by β-galactosidase activity. WMP, wild-type strain in mineral medium with 2.0 mM protocatechuate; MMP, mutant strain in mineral medium with 2 mM protocatechuate; WGP, wild-type strain in mineral medium with protocatechuate and 1 mM glucose; MPG, mutant strain in mineral medium with 2 mM protocatechuate and 1 mM glucose; WLP, wild-type strain in LB broth with 2.0 mM protocatechuate; MLP, mutant strain in LB broth with 2.0 mM protocatechuate; WL, wild-type strain in LB broth; ML, mutant strain in LB broth.

FIG. 5.

Determination of PcaO DNA-binding region and sequences by gel retardation (A), DNase I footprinting (C), and site-directed mutation of the palindromic sequence (B). (A) ³²P-end-labeled promoter fragments (approximately 0.02 pM) were incubated with PcaO (5 pM) at 25°C for 20 min. The positions of fragments F1, F2, F3, F4, and F5 are bases −7 to 59, −34 to 59, −59 to 59, −95 to 59, and −49 to −93, respectively (Fig. 3B). (B) Lane 1, ³²P-labeled pcaHG promoter sequence (bases −96 to −33); lane 2, same as lane 1 but with 5 pM PcaO added; lanes 3 to 5, ³²P-labeled promoter sequences with different mutations in the palindromic sequence with 5 pM PcaO added. For lane 3, AACCCC(N)₈GGGGTT was replaced by CCAAAA(N)₈GGGGTT; for lane 4, AACCCC(N)₈GGGGTT was replaced by AACCCC(N)₈TTTTGG; and for lane 5, AACCCC(N)₈GGGGTT was replaced by CCAAAA(N)₈TTTTGG. The concentration of the ³²P-labeled DNA sequences used in the experiment was 0.02 pM. (C) The 289-bp promoter sequence of the nontemplate strand was labeled using ³²P. Lanes G, A, T, C contained sequencing ladders. Lanes 1 and 2 show the DNase I protection patterns in the presence of 10 pM PcaO, and lane 3 shows the DNase I protection pattern in the absence of PcaO. The concentration of the ³²P-labeled DNA sequence used in the experiment was 0.5 pM.

FIG. 6.

Effects of PCA (A), ATP (B), ADP (C), and AMP (D) on the binding affinity of PcaO for its target sequence. PCA was not included in the experiments whose results are shown in panels B to D. In all experiments, the PcaO concentration was 0.5 μM and the concentration of the ³²P-labeled pcaHG promoter sequence was 1 nM.