POT1-TPP1 enhances telomerase processivity by slowing primer dissociation and aiding translocation

Abstract

Telomerase contributes to chromosome end replication by synthesizing repeats of telomeric DNA, and the telomeric DNA-binding proteins protection of telomeres (POT1) and TPP1 synergistically increase its repeat addition processivity. To understand the mechanism of increased processivity, we measured the effect of POT1-TPP1 on individual steps in the telomerase reaction cycle. Under conditions where telomerase was actively synthesizing DNA, POT1-TPP1 bound to the primer decreased primer dissociation rate. In addition, POT1-TPP1 increased the translocation efficiency. A template-mutant telomerase that synthesizes DNA that cannot be bound by POT1-TPP1 exhibited increased processivity only when the primer contained at least one POT1-TPP1-binding site, so a single POT1-TPP1-DNA interaction is necessary and sufficient for stimulating processivity. The POT1-TPP1 effect is specific, as another single-stranded DNA-binding protein, gp32, cannot substitute. POT1-TPP1 increased processivity even when substoichiometric relative to the DNA, providing evidence for a recruitment function. These results support a model in which POT1-TPP1 enhances telomerase processivity in a manner markedly different from the sliding clamps used by DNA polymerases.

Figure 1

POT1–TPP1 increases the processivity of telomerase. (A) Telomerase catalytic cycle. Rate constants k_on and k_off represent the association and dissociation of a DNA primer substrate with telomerase. Once the primer has been extended, its dissociation rate constant is k_off′. Rate constant k_pol is a composite rate constant, which is determined by the rate-limiting step of DNA polymerization. The translocation step is defined by k_trans and the corresponding reverse rate constant. The star represents the active site in TERT; both the DNA and the RNA must move relative to the active site during translocation. Telomerase maintains a more-or-less constant number of base pairs during extension (Forstemann and Lingner, 2005; Hammond and Cech, 1998). (B) Addition of POT1 and TPP1 to primer A5 (TTAGGGTTAGCGTTAGGG) increases repeat addition processivity of telomerase overexpressed in human embryonic kidney cells. This primer was chosen because the single-C substitution positions POT1–TPP1 on the 5′ end (Wang et al, 2007). Reactions were extended for 30 min at 30°C with telomerase extract alone, or with the addition of 1 μM purified POT1 (P), TPP1 (T), or both POT1 and TPP1 (PT); primer at 500 nM. LC, DNA loading control. Numbers on left, number of telomeric repeats added to the primer. (C) POT1–TPP1 increases the processivity of telomerase at various temperatures. Primer 18GTT (250 nM), which has the completely telomeric sequence (AGGGTT)₃, was extended either alone or in the presence of POT1–TPP1 (500 nM) at 4, 8, 16 and 30°C. At each temperature, four time points were taken. The time points at 30°C are more accurately 1, 5, 15 and 30 min. LC, DNA loading control. Numbers on left, number of telomeric repeats added to the primer.

Figure 2

POT1–TPP1 decreases the dissociation rate of extending telomerase enzyme and increases the translocation rate. (A) Extending primer dissociation rate assay. Telomerase and primer TTTA5 (50 nM) (TTTTTAGGGTTAGCGTTAGGG) were incubated either alone or with POT1–TPP1 (‘+PT,' 100 nM) for 30 min at room temperature. The reactions were then moved to 16°C for 5 min to chill. At time t=−5 min, the dNTPs were added and the reactions were extended for 5 min in the absence of radiolabelled dGTP. At time t=0, chase A5P (TTAGGGTTAGCGTTAGGGp) (2 μM) either alone or with 1.9 μM POT1–TPP1 was added to the reaction. At each time point, 18 μl of the reaction mix were added to 2 μl of radiolabelled dGTP and labelled at 16°C for 5 min. In the first lanes are control reactions: TTTA5 labelled for 5 min, and 30 min, then A5P and premix (A5P+TTTA5) labelled for 5 min. LC, DNA loading control. Numbers on left, number of telomeric repeats added to the primer. (B) Quantitation of panel (A). The total counts (TC) of each lane were measured. Percent bound was calculated as [TC(t=n)/TC(t=0)] × 100 and plotted versus time. The data were fit to a double exponential with a fast phase and a slow phase. Telomerase alone in solid line, and +PT in dashed line. (C) Quantitation of primer off rate from extending telomerase, as in panel (B) but data at 30°C. The data from two gels were averaged together and fit to a double exponential with a fast phase and a slow phase. (D) POT1–TPP1 facilitates translocation step. During the first round of polymerization using oligo 26GTT (100 nM) (TTATTATTAGGGTTAGGGTTAGGGTT), two nucleotides are added, AG (+2 nt). Telomerase then translocates, adds two more nucleotides, GG (+4 nt), and stops because dT was omitted from the reaction. To slow the enzyme enough to measure rate, [Mg²⁺]=0.1 mM and the extension temperature was 4°C. Both POT1 and TPP1 were at 1.5 μM, and 1 μM A5P chase was added at time t=0 to prevent telomerase re-initiation. (E) Model of translocation assay. The first round of addition results in the addition of +2 nt. Telomerase translocates and adds an additional 2 nucleotides (+4) and then stops because dT is absent. (F) POT1–TPP1 increases the efficiency of translocation. The percent translocated was calculated by taking the counts in the +4 and +3 bands divided by the total counts, multiplied by 100%. The product migrating at +0, which is due to a small amount of nuclease activity in some preparations of TPP1, represents <5% of total product, and our conclusions are not affected by whether quantitation includes or excludes the +0 band. Each data set was fit with the equation y=A(1−e^(−kt)) where A is the horizontal limit representing the maximum efficiency (0.99 with and 0.57 without POT1–TPP1). The translocation rate is higher in the presence of POT1–TPP1, as determined from the initial slope of the line; this higher rate is in part due to a higher rate constant (k=0.10/min and 0.07/min in the presence and absence of POT1–TPP1, respectively), and in part due to the fact that the reaction in the absence of POT1–TPP1 has a lower maximum efficiency.

Figure 3

Mutant telomerase reveals requirement for a single POT1–TPP1-binding site in newly synthesized DNA. (A) Cartoon of wild-type (WT) and mutant telomerase template-primer interactions with point mutations in red. (B) Native gel shift of oligonucleotides (50 nM) with POT1–TPP1 (PT) at 0, 150 and 300 nM. (C) Oligonucleotides used in mutant telomerase activity assay. POT1–TPP1-binding site is in blue, mutant repeats are in red. (D) Activity assay of WT telomerase with WT primer, and mutant telomerase with mut1 and mut2 primers. Telomerase alone or in the presence of 1 μM POT1 and TPP1 (PT) with each primer at 1 μM. For all assays comparing WT telomerase and mutant telomerase, total [dGTP]=5 μM, which gives higher processivity than the conditions of Figures 1 and 2. The RAP was quantitated (units=number of repeats). Ratio, processivity with POT1–TPP1 divided by that without POT1–TPP1. (E) Increasing the distance between the POT1–TPP1 site and the 3′ end. Activity assay of mutant telomerase alone, or in the presence of 1.5 μM POT1 and TPP1 (PT) with each gel purified primer (sequences shown in panel C) at 500 nM. Reaction for 30 min.

Figure 4

Stimulation of telomerase processivity is specific to POT1–TPP1. (A) A non-specific single-stranded DNA-binding protein, gp32, was added to telomerase activity assays either alone or with TPP1. Concentrations of gp32 and TPP1 were 0, 1, 2.5, 5 and 7.5 μM. Primer 18GTT was at 1 μM. Because of the presence of 1 mM EDTA in the gp32 protein, 2 mM MgCl₂ was added to both gp32 protein and to mock protein buffer to compensate. Reaction for 30 min. (B) Processivity quantitation of panel (A). The processivity of each lane was calculated and plotted versus the concentration of either gp32 alone (solid bars) or gp32+TPP1 (dashed bars).

Figure 5

POT1–TPP1 stimulates processivity at substoichiometric concentrations. (A) Telomerase activity assay. Primer 18GTT was at 1000 nM. POT1 and TPP1 (PT) concentrations were increased from 1 to 1000 nM. Reaction for 30 min. (B) Quantitation of processivity in panel (A). The processivity value at each point in the titration was calculated as described in Materials and methods and plotted versus the concentration of POT1–TPP1. A straight line (dashed) represents the expected processivity values if POT1–TPP1 did not recruit telomerase to an end.

Figure 6

Model of POT1–TPP1 stimulation of processivity. POT1–TPP1 enhances recruitment of primer to telomerase, and telomerase binds the DNA. Telomerase extends the DNA to the end of the RNA template and translocates the RNA relative to the DNA. The translocation step is more efficient and faster in the presence of POT1–TPP1. Throughout the catalytic cycle, the dissociation of telomerase from DNA is decreased in the presence of POT1–TPP1. By both decreasing the dissociation rate and increasing the efficiency and rate of the translocation step, POT1–TPP1 increases the processivity of telomerase. Here, the POT1–TPP1–telomerase interaction is shown as stable binding, but it could also be more transient as long as it prevents primer dissociation during vulnerable steps in the catalytic cycle.