An insertion of intracisternal A-particle retrotransposon in a novel member of the phosphoglycerate mutase family in the lew allele of mutant mice

Abstract

Intracisternal A-particle retrotransposons (IAPs) are known, moveable, retrovirus-like elements and are defective in envelope protein synthesis in the mouse genome. Insertion of IAP elements can either interupt or enhance gene function or expression. Using a mouse model called lethal wasting (lew), we recently identified the insertion of an IAP sequence in a gene, 9630033F20Rik, that contains domains involved in glycolysis. The expression pattern of the 9630033F20Rik gene between various normal and diseased tissues was determined by semi-quantitative RT-PCR. The effect of the insertion mutation in 9630033F20Rik on glycolysis in heart, muscle, and brain tissues was further investigated using oligonuleotide microarray analysis. Results indicated that the expression of 9630033F20Rik is ubiquitous and its signal is relatively higher in heart and brain tissues. The insertion caused the deletion of exon 5 and decreased expression of this gene in all the tissues studied in the lew mice. Changes in the expression levels of glycolytic genes mainly occured in muscle tissue, raising a possibility that 9630033F20Rik may function as one of the transcriptional regulators of glycolytic genes in skeletal muscle. However, considering the fact that a single nucleotide mutation in vesicle-associated membrane protein 1 (VAMP1) has been reported as the causal gene for the lew mouse, how much of an impact the IAP insertion in the lew mouse phenotype has on glycolytic genes compared to the effect from the VAMP1 mutation responsible for the lew mouse phenotype should be further investigated.

Fig. 1

Physical localization and identification of IAP insertion of Lew gene. 1A. Location and genetic elements of lew locus (9630033F20Rik) previously mapped on murine chromosome 6; 1B. Sequence analysis of exon 5 amplificant of Lew gene from normal (+/+), heterozygous (lew/+), homozygous (lew/lew) mice and a mixture of +/+ with lew/lew samples. The X-axis represents relative size of the PCR products. Y-axis represents relative strength of signal or the amount of the PCR products. 1C. The PCR amplification products of exon 5 of Lew gene from 8 strains of mice and Lew/Lew mouse. A pair of primers (forward: GACTAGGTCACCGGCACACT, reverse AGGCCTTTACCATCATGTCG) was designed to flank exon 5 of a Lew gene with a size of 252 bps. Samples of lane 1–8 were amplification from C3H/HeJ, C57BL/6J, BALB/cJ, DBA/1J, A/J, PL/J, CAST/Ei/J, SJL/J and lew/lew mice respectively. Lane 10 is DNA marker. ; 1D. Long-range PCR amplification of Lew gene. A pair of primers (forward: GATTAGCTGACAAATGAAATCAAAGA, reverse GTTCTCTGAGGTTCAAGAGACATAAA) was designed to flank exon 5 of a Lew gene with a size of 1511 bps. They were used in long-region PCR to amplify a DNA fragment from mice of+/+, lew/+ and lew/lew genome DNA. Samples of lane 1–4 were amplificants from 4 different normal mice; lanes 5–12 were amplificants from 8 different lew/+ mice and lanes 13–21 were amplification products from 9 different individual lew/lew mice; lane 22 is DNA marker

Fig. 2

Consequences of the IAP insertion mutation. 2A. Insertion of partial IAP sequence in the DNA sequence of exon 5 of Lew gene from lew/lew mice. 2B. a stretch of cDNA sequences of Lew gene in +/+ and lew/lew mice. The deleted section of cDNA sequence in lew/lew mice was marked by a dashed arrow. 2C. Predicted amino acid sequences from lew/lew and +/+ mice. Sequences from +/+ and lew/lew mice were in black and red, respectively. The deleted predicted sequence in lew/lew mice was represented by a green bar.

Fig. 3

Expression pattern of Lew in different tissues from normal +/+ and disease lew/lew mice by semi-quantitative RT-PCR. A pair of primers (forward:GGGCAGTTTCTGAGCAATGT, reverse: TCCAACAGGGAAAACCTCTG) was designed to cover from exon 3 to exon 6 of Lew gene with a size of 394 bps. Three individual 14 days old +/+ and three same age matched three lew/lew mice RNA samples from 12 different tissues were used for this experiment and a duplicate well was run for each sample. The figure only shows one sample from each type on the gel image. After electrophoresis (3A) and scanning, all PCR product bands were analyzed by using the software Scion Image and relative mRNA expression was estimated by normalization with Gapdh. The final ratios were calculated by dividing the relative values of different tissues by the lowest value for lung of normal mice (3B).