The effect of ribosome assembly cofactors on in vitro 30S subunit reconstitution

Abstract

Ribosome biogenesis is facilitated by a growing list of assembly cofactors, including helicases, GTPases, chaperones, and other proteins, but the specific functions of many of these assembly cofactors are still unclear. The effect of three assembly cofactors on 30S ribosome assembly was determined in vitro using a previously developed mass-spectrometry-based method that monitors the rRNA binding kinetics of ribosomal proteins. The essential GTPase Era caused several late-binding proteins to bind rRNA faster when included in a 30S reconstitution. RimP enabled faster binding of S9 and S19 and inhibited the binding of S12 and S13, perhaps by blocking those proteins' binding sites. RimM caused proteins S5 and S12 to bind dramatically faster. These quantitative kinetic data provide important clues about the roles of these assembly cofactors in the mechanism of 30S biogenesis.

Figure 1

A) Nomura assembly map. Arrows represent protein-binding dependencies at equilibrium.; Colored circles represent protein binding rates at 40°C as determined by pulse-chase. Red, 10-14 min^-1; orange, 5.4-6 min^-1; green, 2.2-3.6 min^-1; blue, 0.39-0.84 min^-1; purple, 0.14-0.24 min^-1. B) Schematic of pulse-chase experiments with factors. Stable-isotope pulse-chase experiments were performed as described previously with minor changes. PC/QMS experiments were performed by mixing 16S rRNA with assembly factor before adding a pulse of ¹⁵N TP30 and incubating for varying amounts of time, then chasing the assembly reaction with an excess of ¹⁴N TP30. A 2× excess of assembly factor (360 pmol) was preincubated with 180 pmol of 16S rRNA for 20 minutes at 40°C in a volume of 555 μl of reconstitution buffer (RB, 25 mM Tris pH 7.5, 20 mM MgCl₂, 330 mM KCl, 2 mM DTT). For the experiment with Era, the KCl concentration was 250 mM during the pre-incubation, and then 30 sec before the pulse, 60 μl of 100 μM GTP in a higher KCl buffer was added, bringing the KCl concentration to 330 mM and the GTP concentration to 10 μM. The pulse consisted of 45 μl of 6 μM ¹⁵N TP30 in RB, and ranged in length from 10 sec to 40 min. After addition of a chase of 135 μl of 10 μM ¹⁴N TP30 in RB, the assembly reaction was incubated a further 40 min at 40°C and then chilled on ice. Sample processing and LC-MS analysis were performed as described previously., Briefly, the 30S subunits were loaded onto sucrose gradients and purified by ultracentrifugation. The r-proteins were extracted, digested with trypsin, and analysed by LC-MS using an Agilent ESI-TOF. In-house peptide identification software was used which takes advantage of the difference between ¹⁴N and ¹⁵N peptide peaks for identification purposes. Quantitation was performed using an isotope fitting approach called least squares Fourier transform convolution (LS-FTC).

Figure 2

The kinetic effects of Era, RimM, and RimP on in vitro reconstitutions. a) – f) Protein binding progress curves of selected proteins showing an experiment with RimM (red), RimP (green), Era (purple) and a control (blue). Curves marked with asterisks are fit to a double exponential based on the results of a statistical f-test, using a 95% confidence interval. Era, RimM and RimP were prepared as follows. Plasmids pSTN022, pMW487 and pSTN021 encoding N-terminally his-tagged Era, RimM and RimP, respectively, expressed from a T7/lac promoter were constructed by PCR amplification of DNA fragments containing the respective structural gene using the following primer pairs: era-pETM10-F (5′ CATGCCATGGGCATCGATAAAAGTTACTGCGG 3′) and era-pETM10-R (5′-CATGCTCGAGTTAAAGATCGTCAACGTAACCGAG-3′), rimM-NcoI-F (5′-GGTCACCATGGGCAAACAACTCACCGCGCAA-3′ and rimM-pETM10-R (5′-CATGCTCGAGTTTAAAAACCAGGATCCCAATCTAC-3′), yhbC-pETM10-F (5′--CATGCCATGGGCTTGTCCACATTAGAGC-3′) and yhbC-pETM10-R (5′-CATGCTCGAGTTAAAAGTGGGGAACCAGGTTCG-3′), and cloning of the DNA fragments, after trimming of their ends with NcoI and XhoI, into NcoI and XhoI digested expression vector pETM10 (http://www.pepcore.embl.de/strains_vectors/vectors/bacterial_expression.html). Plasmid clones verified by DNA sequencing were introduced into strain BL21 (DE3) for overproduction of the respective proteins. The resulting strains were grown in LB at 37°C to a cell density of approx. 50 Klett units, at which 0.5 mM IPTG was added, to induce expression from the T7/lac promoter on the plasmids, and the temperature shifted to ∼21°C for further incubation overnight. Cells from 1 L of culture were harvested by centrifugation and dissolved in 5 ml of 20 mM Tris-HCl, pH 8.0, containing 0.5 M NaCl, 10% glycerol and 5mM imidazole, then 55 μl of 100 mM phenylmethanesulphonylfluoride (PMSF) and 250 μl of 10 mg/ml lyzosyme were added before freeze/thawing three times in liquid nitrogen/water, followed by 80 min centrifugation (20,800 × g) at 4°C. The obtained supernatants were passed through Ni-NTA columns (Qiagen) by gravity flow, the columns were washed with 5 ml aliquots of 20 mM Tris-HCl, pH 8.0, containing 0.5 M NaCl, 10% glycerol and increasing concentrations of imidazole (5, 20, 50, 100 and 500 mM, respectively). Wash fractions containing the respective proteins were pooled and further purified by FPLC using a HiLoad 16/60 Superdex 200 prep grade column (GE Healthcare Life Sciences) equilibrated in 20 mM Tris-HCl, pH 8.0, containing 0.5 M NaCl and 10% glycerol. Prior to kinetic experiments, the proteins were dialysed into TKMD (25 mM Tris pH 7.5, 20 mM MgCl₂, 1 M KCl, 2 mM DTT) for several hours or overnight. Native 30S subunits, 16S rRNA, and total r-proteins (TP30) were prepared from E. coli MRE600 cells as previously described, except that cells were lysed using a Bead Beater (BioSpec).

Figure 3

First-order calculated rates of the control experiment compared with those from an experiment with a) Era, b) RimM, and c) RimP. Bounding boxes show fit errors. Black line is y = x. For S9, the rate increase in the presence of Era occurred mainly in the faster of two kinetic phases, indicating that some pre-30S particles are better substrates for Era than others. The kinetic changes observed for S13 with Era and RimP are very subtle, although the calculated rates suggest that S13 binds significantly faster in the presence of Era.

Figure 4

Proposed cotranscriptional model of in vivo 30S ribosome assembly and the point at which factors RimM, RimP, and Era are required. The cartoon 30S is made up of 3 major domains: the 5′ domain (lower left), the central domain (upper left) and the 3′ major domain (upper right). The 3′ minor domain is in the center. Proteins are colored as in Fig. 1. Proteins bind to the nascent, unfolded rRNA (pink) as soon as their binding sites become available. Era is involved throughout several steps of assembly, while RimM facilitates 3′ domain assembly, RimP acts during the later stages of protein binding, and RNAses mature the rRNA termini.