Oncolytic herpes simplex virus armed with xenogeneic homologue of prostatic acid phosphatase enhances antitumor efficacy in prostate cancer

Abstract

Prostate cancer is one of the most prevalent cancers in men. Replication-competent oncolytic herpes simplex virus (oHSV) vectors are a powerful antitumor therapy that can exert at least two effects: direct cytocidal activity that selectively kills cancer cells and induction of antitumor immunity. In addition, oHSV vectors can also function as a platform to deliver transgenes of interest. In these studies, we have examined the expression of a xenogeneic homologue of the prostate cancer antigen, prostatic acid phosphatase (PAP), with the goal of enhancing virotherapy against PAP-expressing tumors. PAP has already been used for cancer vaccination in patients with prostate cancer. Here we show that treatment with oHSV bPDelta6 expressing xenogeneic human PAP (hPAP) significantly reduces tumor growth and increases survival of C57/BL6 mice bearing mouse TRAMP-C2 prostate tumors, whereas expression of syngeneic mouse PAP (mPAP) from the same oHSV vector did not enhance antitumor activity. Treatment of mice bearing metastatic TRAMP-C2 lung tumors with oHSV-expressing hPAP resulted in fewer tumor nodules. To our knowledge, this is the first report of oncolytic viruses being used to express xenoantigens. These data lend support to the concept of combining oncolytic and immunogenic therapies as a way to improve therapy of metastatic prostate cancer.

Figure 1. Characterization of bPΔ6-transgene vectors

(A) bPΔ6-hPAP viruses infect and spread in Vero and mouse prostate cancer cells. Vero (African Green Monkey Kidney) cells (American Type Culture Collection, Manassas, VA) were cultured in DMEM with glucose (4.5 g/L; Mediatech, Inc.,Herndon, VA) supplemented with 10% calf serum. TRAMP-C2 ^, , obtained from Dr. N. Greenberg (Fred Hutchinson Cancer Research Center, Seattle, WA), and RM-1 , obtained from Dr. T. C. Thompson (Baylor College of Medicine, Houston, TX), were cultured as previously described. Cells were seeded at 80% confluency and 24 hours later infected with bPΔ6-hPAP at a multiplicity of infection (MOI)=1. Cultures were fixed 18 hours post-infection and stained for β-galactosidase expression with X-Gal (1 mg/ml), 5 mM potassium ferricyanide, 5 mM potassium ferrocyanide, 2 mM magnesium chloride in PBS for 4 hours at 37°C. Cells were washed with PBS, counter-stained with neutral red solution and β-galactosidade expression and viral spread visualised under a light microscope. (B) Virus replication assays. Vero cells were seeded at 1×10⁵ cells/well in 12-well plates and 24 hours later infected with either bPΔ6-hPAP, bPΔ6-empty or wt viruses at MOI=1. Two hours post-infection the inoculum was removed and replaced with medium (DMEM/1% inactivated FCS). Cells and medium were harvested at indicated times post-infection, processed with freeze/thaw cycles and sonication, and titered on Vero cells. Virus yield is plotted as plaque-forming units (pfu)/ml. (C) Cell viability assays. TRAMP-C2 cells were seeded into 96-well plates at 5000 cells/well and 24 hours later infected with bPΔ6-hPAP (IC50=2.5) or bPΔ6-empty (IC50=2.9) at 3-fold serial dilutions (from 0.01 to 10 PFU/cell). Cell viability was assessed 4 days post-infection with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (Sigma) according to the manufacturer’s instructions.

Figure 2. PAP expression

(A) RT-PCR analysis of Vero cells infected with bPΔ6-mPAP shows mPAP mRNA expression. Cells were grown in 6-well plates and infected at 90-95% confluence with either bPΔ6-hPAP, bPΔ6-mPAP or bPΔ6-empty viruses at MOI=2. After 2 hrs, virus inoculum was removed and replaced with medium DMEM/1% inactivated FCS. Eight hours later the total RNA fraction was isolated from cell lysates using TRIZOL (Invitrogen, USA), and treated with RQ1 RNase-free DNase I (Promega, Madison, WI). Reverse transcription was carried out using SuperScriptIII First Strand Synthesis kit (Invitrogen, USA) and random hexamer primers. cDNAs were subjected to conventional PCR (5 min at 95°C then 28 cycles: 30 seconds at 95°C, 15 seconds at 68°C, 20 seconds at 72°C; and terminal elongation 2 min at 72°C) with specific primers: P1^mPAP619 5′ – gcttcctggacaccttgtcgtcgctgtcg – 3′ and P2^mPAP1214 5′ – attccgtccttggtggctgc – ^3′, designed to generate a PCR product of 595 bp. As a positive control, plasmid DNA (pVec92-mPAP) was used and the PCR reaction was performed without the reverse transcription step. The reaction product was analyzed by 1.2% agarose gel electrophoresis and stained with ethidium bromide. (B) Western blot analysis of hPAP expression in CT-26 colorectal carcinoma , RM-1 and TRAMP-C2 cell lines after infection with bPΔ6-hPAP (indicated by +) or bPΔ6-empty (indicated by -) at MOI=2. Human prostate adenocarcinoma LNCaP cells and human embryonic kidney 293 cells were used as controls. Cell lysates were prepared using RIPA buffer 24 hours post-infection. Each lysate was separated by SDS-polyacrylamide electrophoresis, transferred to PVDF membrane (BioRad), and immunoblotted with anti-hPAP (DAKO Rabbit anti-Human PAP, A0627) antibody (diluted 1:1000) using standard procedures. (C) Mouse prostate cancer cells express PAP. Total RNA was isolated from LNCaP, TRAMP-C2 and RM-1 cells and RT-PCR was performed using primers previously described . mPAP mRNA was observed in both TRAMP-C2 and RM -1 cells but not in human LNCaP prostate cancer cells. (D) In vivo expression of hPAP. TRAMP-C2 cells (5×10⁶/mouse) were implanted subcutaneously into the flanks of male six to eight-week-old C57/BL6 mice (National Cancer Institute, Frederick, MD). Once tumors were established (50-10 mm³) mice were treated intraneoplastically once with bPΔ6-hPAP (2×10⁷ pfu). After 48 hours, tumors were harvested, homogenized and centrifuged. Supernatants were assayed for hPAP using an ELISA Kit (R&D Systems, Minneapolis, MN) according to manufacturer’s instructions. Error bars represent the standard deviation of 3 measurements. All in vivo procedures were approved by the Massachusetts General Hospital Subcommittee on Research Animal Care.

Figure 3. Mice treated with bPΔ6-hPAP show tumor reduction and increased survival

C57/BL6 mice were implanted subcutaneously in the flanks with TRAMP-C2 cells (5×10⁶/mouse). Once tumors were established (50-100 mm³) mice (N=8) were randomized and treated four times with 1×10⁷ pfu of bPΔ6-empty, bPΔ6-mPAP, bPΔ6-hPAP or PBS over a period of 10 days by direct intra-tumoral inoculation. Tumor volumes were monitored using calipers and calculated with the formula v = [(length) × (width²)] / 2. Mice were sacrificed when tumors reached 1000 mm³. Animals treated with bPΔ6-hPAP showed a significant reduction in tumor volume (p=0.002, PBS vs hPAP: p=0.04, Empty vs hPAP: p=0.03, mPAP vs hPAP) (A) and a significant increase in survival (B) when compared with the bPΔ6-mPAP (p=0.01), bPΔ6-empty (0.01) or PBS (p=0.0008) groups. Analysis of tumor volumes (day 24, Student’s t-test) and survival (log-rank test) were performed with GraphPad Prism v.4 (San Diego, CA).