Tandem repeat coupled with endonuclease cleavage (TREC): a seamless modification tool for genome engineering in yeast

Abstract

The complete synthetic Mycoplasma genitalium genome ( approximately 583 kb) has been assembled and cloned as a circular plasmid in the yeast Saccharomyces cerevisiae. Attempts to engineer the cloned genome by standard genetic methods involving the URA3/5-fluoroorotic acid (5-FOA) counter-selection have shown a high background of 5-FOA resistant clones derived from spontaneous deletions of the bacterial genome maintained in yeast. Here, we report a method that can seamlessly modify the bacterial genome in yeast with high efficiency. This method requires two sequential homologous recombination events. First, the target region is replaced with a mutagenesis cassette that consists of a knock-out CORE (an18-bp I-SceI recognition site, the SCEI gene under the control of the GAL1 promoter, and the URA3 marker) and a DNA fragment homologous to the sequence upstream of the target site. The replacement generates tandem repeat sequences flanking the CORE. Second, galactose induces the expression of I-SceI, which generates a double-strand break (DSB) at the recognition site. This DSB promotes intra-molecular homologous recombination between the repeat sequences, and leads to an excision of the CORE. As a result, a seamless modification is generated. This method can be adapted for a variety of genomic modifications and may provide an important tool to modify and design natural or synthetic genomes propagated in yeast.

Figure 1.

A traditional method of genetic engineering the MG259 locus of a synthetic M. genitalium genome maintained in yeast. (A) The scheme of repairing a point mutation through two homologous recombination procedures. First, a region of 146 bp with point mutation (asterisk) in the MG259 locus of M. genitalium genome (M. gen genome) is replaced with the URA3 marker via 50-bp homologous sequences. Second, a 328-bp DNA fragment replaces the URA3 marker. The loss of the URA3 marker is selected for by 5-FOA. Two PCR diagnosis primers (red arrows), Seq-F (gttagtttaccaatccagtc) and Seq-R (aatgcttggatatcaatatc), are separated by 0.4 kb in MG259 locus, and the insertion of the 1.1-kb URA3 marker results in the generation of a 1.3-kb PCR product when using these primers. (B) PCR analysis of 22 5-FOA resistant clones after the second round of homologous recombination using primers Seq-F and Seq-R. C1, DNA purified from the yeast strain containing an M. genitalium genome with the URA3 marker insertion in MG259 locus and C2, DNA purified from the yeast strain containing an M. genitalium genome before the insertion of URA3 marker in MG259 locus. (C) Analysis of M. genitalium genome completeness by multiplex PCR. Ten pairs of primers should produce 10 amplicons (ranging from 0.125 to 1.25 kb in 0.1-kb increments) distributed around the M. genitalium genome approximately every 60 kb as shown in control C1 DNA and C2 DNA. M, 100-bp DNA ladder and 1–22: DNA analyzed from 22 5-FOA resistant colonies. (D) Possibilities for URA3 marker loss from an M. genitalium cloned in yeast. A 583 kb of the M. genitalium genome was cloned as yeast artificial chromosome (YAC), carrying a histidine marker (HIS3) and a centromere (CEN6), and the URA3 marker was inserted into the MG259 locus. 5-FOA resistant strains (5-FOA⁺) could be derived either from the replacement of the URA3 marker with the wild type DNA fragment (R1) or from recombination between two repetitive sequences (blue arrow) (R2). Size and locations of repeat sequences are schematic.

Figure 2.

Seamless deletion using the TREC method. (A) The outline of the TREC method. Through homologous recombination, a 450-bp region located at the MG259 locus is replaced with a mutagenesis cassette that consists of a knock-out CORE (an18-bp I-SceI recognition site, the SCEI gene under the control of a GAL1 promoter, and the URA3 marker) and a DNA fragment (shown in white arrow) identical to a region upstream of the target site. The replacement generates tandem repeat sequences flanking the CORE. Galactose induces the expression of I-SceI, which generates a double-strand break (DSB) at the I-SceI site near the target locus. The DSB promotes an intra-molecular homologous recombination (dash line) between the repeat sequences, leading to an excision of the CORE. (B) Replica-plating steps used for selection of M. genitalium genome modification. URA3 positive transformants were grown on SD-HIS-URA medium, followed by replica plating to either galactose or glucose plates. After a 2-day incubation, cells were replica-plated onto SD-HIS containing 5-FOA. 5-FOA-resistant cells were re-streaked out to produce single colonies for PCR analyses. (C) PCR analysis using the diagnosis primers, Seq-F and M2-det1(aagtaactagcaatttgttg), for excision of the mutagenesis cassette. DNA was prepared from 24 colonies replica-plated from either galactose or glucose plate, respectively. DNA with a precise deletion would give rise to a 0.55-kb PCR product, compared to a 1-kb PCR product from un-modified DNA. (D) Analysis of the integrity of the M. genitalium genome. Ten DNA samples from galactose-induced and -uninduced 5-FOA resistant clones in (C) were further analyzed by multiplex PCR using the same primer sets described in Figure 1C. M, 100-bp DNA ladder. C, DNA purified from Ura⁺ transformants before galactose induction and 5-FOA selection.