The fluorescence properties and lifetime study of G-quadruplexes single- and double-labeled with pyrene
- PMID: 20358281
- DOI: 10.1007/s10895-010-0653-x
The fluorescence properties and lifetime study of G-quadruplexes single- and double-labeled with pyrene
Abstract
We report steady state fluorescence and lifetime emission studies of d(GGTTGGTGTGGTTGG) (TBA) and d(GGGTTAGGGTTAGGGTTAGGG) (Htelom) oligonucleotides labeled with pyrene through a 3-aminopropyl linker. Such G-rich sequences are able to self-assemble into G-quadruplexes, especially in the presence of specific cations like potassium. A comparative studies with single- and double-labeled G-quadruplexes were carried out. For each probe we have measured fluorescence decays for emission wavelength of 390 and 480 nm in the varying concentration of potassium ion. We have calculated average lifetimes <τ> for every system as well as the fractional distribution α(i) of emitting species.
Similar articles
-
Interactions of sodium and potassium ions with oligonucleotides carrying human telomeric sequence and pyrene moieties at both termini.Bioorg Med Chem. 2008 Nov 15;16(22):9871-81. doi: 10.1016/j.bmc.2008.08.035. Epub 2008 Aug 26. Bioorg Med Chem. 2008. PMID: 18851918
-
An aptamer-based fluorescent biosensor for potassium ion detection using a pyrene-labeled molecular beacon.Anal Biochem. 2010 May 1;400(1):99-102. doi: 10.1016/j.ab.2009.12.034. Epub 2010 Jan 6. Anal Biochem. 2010. PMID: 20056100
-
Label-free dual assay of DNA sequences and potassium ions using an aptamer probe and a molecular light switch complex.Chem Commun (Camb). 2009 Dec 21;(47):7419-21. doi: 10.1039/b915994k. Epub 2009 Oct 22. Chem Commun (Camb). 2009. PMID: 20024248
-
FRET study of G-quadruplex forming fluorescent oligonucleotide probes at the lipid monolayer interface.Spectrochim Acta A Mol Biomol Spectrosc. 2016 Jan 5;152:614-21. doi: 10.1016/j.saa.2015.01.102. Epub 2015 Feb 7. Spectrochim Acta A Mol Biomol Spectrosc. 2016. PMID: 25698056
-
Fluorescence detection of potassium ion using the G-quadruplex structure.Anal Sci. 2011;27(12):1167-72. doi: 10.2116/analsci.27.1167. Anal Sci. 2011. PMID: 22156241 Review.
Cited by
-
Recent Advances in Nucleic Acid Targeting Probes and Supramolecular Constructs Based on Pyrene-Modified Oligonucleotides.Molecules. 2017 Nov 30;22(12):2108. doi: 10.3390/molecules22122108. Molecules. 2017. PMID: 29189716 Free PMC article. Review.
References
Publication types
MeSH terms
Substances
LinkOut - more resources
Full Text Sources