Viral detection using DNA functionalized gold filaments

Abstract

Early detection of pediatric viruses is critical to effective intervention. A successful clinical tool must have a low detection limit, be simple to use and report results quickly. No current method meets all three of these criteria. In this report, we describe an approach that combines simple, rapid processing and label free detection. The method detects viral RNA using DNA hairpin structures covalently attached to a gold filament. In this design, the gold filament serves both to simplify processing and enable fluorescence detection. The approach was evaluated by assaying for the presence of respiratory syncytial virus (RSV) using the DNA hairpin probe 5' [C6Thiol]TTTTTTTTTTCGACGAAAAATGGGGCAAATACGTCG[CAL] 3' covalently attached to a 5 cm length of a 100 microm diameter gold-clad filament. This sequence was designed to target a portion of the gene end-intergenic gene start signals which is repeated multiple times within the negative-sense genome giving multiple targets for each strand of genomic viral RNA present. The filament functionalized with probes was immersed in a 200 microm capillary tube containing viral RNA, moved to subsequent capillary tubes for rinsing and then scanned for fluorescence. The response curve had a typical sigmoidal shape and plateaued at about 300 plaque forming units (PFU) of viral RNA in 20 microL. The lower limit of detection was determined to be 11.9 PFU. This lower limit of detection was approximately 200 times better than a standard comparison ELISA. The simplicity of the core assay makes this approach attractive for further development as a viral detection platform in a clinical setting.

Fig. 1

Illustration of the filament-based assay method. In an analyte solution, a conformational change is observed when the molecular beacon style probe DNA binds target DNA/RNA. In the closed conformation (negative), the fluorophore is in close proximity to the gold surface and is quenched. Upon binding the target (positive), the fluorophore becomes spatially separated from the gold surface. After binding the target, the filaments are rinsed and mounted to a glass slide for imaging. Upon excitation at the desired wavelength (532 nm), fluorophores that have bound target and are in an open conformation will exhibit a distinct fluorescence signal (575 nm).

Fig. 2

Effect of probe spacing on fluorescence. Comparison of the signal-to-noise ratio of filaments functionalized with mixed monolayers of RSV probe DNA and mercaptohexanol.

Fig. 3

Specificity of probe functionalized filaments. Comparison of filament-functionalized RSV probes in the presence of increasing concentrations of RSV target DNA and nonspecific femA target DNA.

Fig. 4

Response of probe DNA upon target binding. (A) The average fluorescence along filaments functionalized with RSV probe DNA that have been exposed to lysates from either uninfected HEp-2 cells (left) or RSV-infected cells (right). (B) An image of these same filaments.

Fig. 5

Effect of target RNA length on detection. (A) Electropherogram verifying the hydrolysis of RNA at each of the time points. (B) Average fluorescence and an image showing the effect of target RNA length on the resulting signal. At fifteen minutes the highest signal was observed.

Fig. 6

Comparison of the RSV detection using ELISA or the developed filament-based assay. The limit of detection using ELISA was 1750 PFU while the filament had a limit of detection of 11.9 PFU.