beta(1-3)Glucanosyltransferase Gel4p is essential for Aspergillus fumigatus

Abstract

The beta(1-3)glucanosyltransferase GEL family of Aspergillus fumigatus contains 7 genes, among which only 3 are expressed during mycelial growth. The role of the GEL4 gene was investigated in this study. Like the other Gelps, it encodes a glycosylphosphatidylinositol (GPI)-anchored protein. In contrast to the other beta(1-3)glucanosyltransferases analyzed to date, it is essential for this fungal species.

Fig. 1.

Expression level of the GEL1, GEL2, and GEL4 genes during growth. Gene expression was determined by real-time RT-PCR in resting conidia (0 h), germinated conidia (8 h), and mycelia (20 h) incubated in 3% glucose-1% yeast extract at 37°C. Triplicate biological RT-PCR assays were performed using 1× iQ SYBR green master mix, and expression levels were normalized to those of TEF1. The threshold cycle (2^−ΔΔCT) method was used to determine fold changes of expression. Primer pairs used were Gel1a (TTCGCTACCGTTGATGCTTTCG)-Gel1b (TGCGGCTACGGATGTACTGAC); Gel2a (GCCTCTCCGACGCTAACAC)-Gel2b (GGTATTGGACTCGCCGCTAG); Gel4a (ATACGCCACCGACGAGGAC)-Gel4b (GGAAGAATCACCGCACCACTC); and Tef1a (CCATGTGTGTCGAGTCCTTC)-Tef1b (GAACGTACAGCAACAGTCTGG).

Fig. 2.

(A to C) Deletion of GEL4 in A. fumigatus using the heterokaryon rescue method. (A) Strategy used to insert the hygromycin resistance gene (HPH) inside GEL4 (E, EcoRI site). (B and C) PCR and Southern blot analyses showing the presence of both wild-type and mutated alleles in the heterokaryon (H) and the absence of the mutated allele in the wild-type strain (WT). The PCR primer pair used in the heterokaryon and in the wild-type strain to show the presence of a wild-type allele is GEL4heteroc1 (CCAAACCAAATCATCAGCCCCAGCCCCAATC)-GEL4heteroc2 (GTAGTCGGCCAAGTCGGCACGGATGTGGGCG), and the pair used to show the presence of a deleted allele is GEL4heteroc1-HYGRO (CGACAGCGTCTCCGACCTGATGCAGCTCTC). For Southern blotting, genomic DNA was digested with EcoRI and hybridized with probe A. DNA isolated from the wild-type strain showed one band of 6.3 kb corresponding to a copy of the wild-type allele, whereas the DNA isolated from the heterokaryon showed the wild-type allele and the mutated allele at 4.1 kb (see panel A). (D) Solubilization of membrane-bound Gel4p with GPI-PLC. Aqueous upper phase (marked “A”) and detergent lower phase (marked “D”) after Triton X-114 partitioning of GPI-PLC-treated (+) or control (−) membranes; immunolabeling with anti-Gel4p hyperimmune antiserum.

Fig. 3.

HPAEC analysis of products obtained from the incubation of the recombinant Gel1p and Gel4p with reduced laminarioligosaccharides. Recombinant proteins (1.17 μg purified) were incubated with 9 mM reduced laminarioligosaccharide containing 26 glucose units in 28 μl of 50 mM sodium acetate buffer, pH 5.5, at 37°C. Aliquots (1.5 μl) supplemented with 200 μl 50 mM NaOH were analyzed by HPAEC with a CarboPac PA200 column (3 by 250 mm; Dionex) and a pulsed electrochemical detector. Note that the last peak (indicated by an arrow) corresponds to water-insoluble products.

Fig. 4.

(A) Phylogenetic tree of proteins of A. fumigatus, Schizosaccharomyces pombe, Saccharomyces cerevisiae, and Candida albicans belonging to the GH72 family. Protein alignment was made with ClustalX, bootstrap values were calculated with PhyML, and the tree was drawn with MEGA software. The protein sequences used are from the indicated species, as follows (Swiss-Prot accession numbers are listed in parentheses): from S. pombe, Spgas1p (Q9P378), Spgas2p (Q9USU5), Spgas4p (Q9Y7Y7), and Spgas5p (O13692); from S. cerevisiae, Gas1p (P22146), Gas2p (Q06135), Gas3p (Q03655), Gas4p (Q08271), and Gas5p (Q08193); from Candida albicans, CaPhr1p (P43076), CaPhr2p (O13318), CaPhr3p (Q9P8R2), CaPga4p (Ca019.4035), and CaPga5p (Ca019.3693); and from Aspergillus fumigatus, AfGel1p (AFUA_2G01170), AfGel2p (AFUA_6G11390), AfGel3p (AFUA_2G12850), AfGel4p (AFUA_2G05340), AfGel5p (AFUA_8G02130), AfGel6p (AFUA_3G13200), and AfGel7p (AFUA_6G12410). (Right) Schematized domains of the 3 subfamilies of GH72, consisting of the signal peptide, catalytic domain, cysteine domain or CBM43 (I), S/T-rich domain, and GPI anchor. Aspergillus fumigatus proteins are shown in boldface. (B) Hypothetical representation of the in situ localization of a member of the GH72⁺ ST⁺ subfamily, such as AfGel4p. CBM43 directs the catalytic site toward the β(1-3)glucan chain. After being anchored, the catalytic domain is able to modify the oligosaccharide.