p27 suppresses arsenite-induced Hsp27/Hsp70 expression through inhibiting JNK2/c-Jun- and HSF-1-dependent pathways

Abstract

p27 is an atypical tumor suppressor that can regulate the activity of cyclin-dependent kinases and G(0)-to-S phase transitions. More recent studies reveal that p27 may also exhibit its tumor-suppressive function through regulating many other essential cellular events. However, the molecular mechanisms underlying these anticancer effects of p27 are largely unknown. In this study, we found that depletion of p27 expression by either gene knock-out or knockdown approaches resulted in up-regulation of both Hsp27 and Hsp70 expression at mRNA- and promoter-derived transcription as well as protein levels upon arsenite exposure, indicating that p27 provides a negative signal for regulating the expression of Hsp27 and Hsp70. Consistently, arsenite-induced activation of JNK2/c-Jun and HSF-1 pathways was also markedly elevated in p27 knock-out (p27(-/-)) and knockdown (p27 shRNA) cells. Moreover, interference with the expression or function of JNK2, c-Jun, and HSF-1, but not JNK1, led to dramatic inhibition of arsenite-induced Hsp27 and Hsp70 expression. Collectively, our results demonstrate that p27 suppresses Hsp27 and Hsp70 expression at the transcriptional level specifically through JNK2/c-Jun- and HSF-1-dependent pathways upon arsenite exposure, which provides additional important molecular mechanisms for the tumor-suppressive function of p27.

FIGURE 1.

p27 suppresses Hsp27 and Hsp70 induction upon arsenite exposure. A, immortalized p27^+/+ and p27^−/− MEFs were exposed to arsenite at different doses and time periods as indicated. Hsp27 and Hsp70 protein expression was determined by Western blot assay. β-Actin was used as a loading control. B, 24 h after p27^−/− cells were infected with Ad carrying full-length GFP-tagged p27 cDNA or a GFP vector control, the cells were treated with arsenite for 12 h. The protein expression levels of Hsp27, Hsp70, and p27 were determined by Western blotting. C, mouse p27 shRNA or non-silencing control shRNA was stably transfected into WT MEFs, and the knockdown efficiency was confirmed by Western blot assay (left panel). The same shRNA transfectants were exposed to arsenite for 9 h. The induction of Hsp27 and Hsp70 was evaluated by Western blotting (right panel). D, p27^+/+ and p27^−/− MEFs were treated with 20 μm arsenite for 12 h, and images were taken under an inverted microscope to record cell death. E, p27 knockdown cells and control cells were exposed to arsenite, and caspase-3 activation and poly(ADP-ribose) polymerase (PARP) cleavage were determined by Western blot assay.

FIGURE 2.

p27 down-regulates hsp27 and hsp70 transcriptional induction in response to arsenite. A, after p27^+/+ and p27^−/− MEFs were treated with 20 μm arsenite for 3, 6, and 12 h, RT-PCR was conducted to determine the mRNA expression levels of hsp27 and hsp70. B, hsp27 and hsp70 promoter-driven luciferase (Luc) reporters were transiently transfected into p27^+/+ and p27^−/− cells in combination with the pRL-TK vector as an internal control. 48 h post-transfection, the cells were treated with 20 μm arsenite for 12 h. The luciferase activities were then evaluated as described under “Materials and Methods.” The results are presented as luciferase activity relative to the medium control. Each bar indicates the mean ± S.D. of triplicate assay wells. *, significant difference in -fold induction between p27^−/− and p27^+/+ cells (p < 0.05).

FIGURE 3.

Induction of Hsp27 and Hsp70 by arsenite requires the JNK2/c-Jun pathway and HSF-1 activation. A and B, the TAM67 construct or the empty vector was transfected into mouse epidermal JB6 Cl41 cells, and the stable transfectants were established by G418 selection. The phosphorylation of c-Jun at Ser⁷³ at 16 h after arsenite exposure (A) and the expression levels of Hsp27 and Hsp70 at 24 h after arsenite exposure (B) were detected by Western blotting. C and D, mouse JNK1 or JNK2 shRNA or non-silencing control shRNA was transfected into JB6 Cl41 cells, and the stable transfectants were established by puromycin selection. The phosphorylation of c-Jun at Ser⁷³ (C) and the induction of Hsp27 and Hsp70 (D) in those stable transfectants upon arsenite exposure were determined. E, HSF-1^+/+ and HSF-1^−/− MEFs were exposed to arsenite for 12 h, and Hsp27 and Hsp70 induction was detected by Western blotting.

FIGURE 4.

JNK2/c-Jun pathway regulates HSF-1 activation due to arsenite exposure. A and B, mouse JNK1 or JNK2 shRNA or non-silencing control shRNA stable transfectants of JB6 Cl41 cells were exposed to arsenite as indicated. HSF-1 activation was compared in those transfectants by detecting the retarded migration band in Western blotting. C and D, the phosphorylation of JNKs and/or c-Jun induced by arsenite was determined by Western blotting in the indicated cell lines. The loading controls (β-actin) were the same as in Fig. 3 (A and E, respectively).

FIGURE 5.

p27 inhibits activation of the JNK/c-Jun and HSF-1 pathways in the cellular response to arsenite. A and B, the phosphorylation of JNKs and c-Jun induced by arsenite was determined in p27^+/+ and p27^−/− MEFs (A) or p27 shRNA and non-silencing transfectants (B) as indicated by Western blotting. The loading control (β-actin) for the lower panel in A is the same as in Fig. 1A (12 h). C, The phosphorylation of the AKT/MKK pathway induced by arsenite for 6 h was determined in p27^+/+ and p27^−/− MEFs as indicated by Western blotting. D, the biotin-labeled probes ⁻¹⁷⁸⁵AGTACTGTCTTAGTCAGGATTT⁻¹⁷⁶⁴ (for the mouse hsp27 promoter) and ⁻²⁹⁹⁴GGACTCTTGACTCAGAGCACA⁻²⁹⁷⁴ (for the mouse hsp70 promoter) were incubated with nuclear extracts from arsenite-treated or untreated p27^+/+ and p27^−/− MEFs, and a 30- and/or 50-fold molar excess of the unlabeled probe was used in the competition analysis. E, both hsp70-Luc-WT and hsp70-Luc-AP-1-mutant were transiently transfected into p27^+/+ and p27^−/− cells. The Hsp70 transcriptional induction was analyzed by luciferase assay upon arsenite treatment. The results are presented as luciferase activity relative to the medium control. Each bar indicates the mean ± S.D. of three independent experiments. *, significant decrease in the luciferase induction in comparison with the wild-type luciferase reporter (p < 0.05). F, soluble chromatin prepared from arsenite-treated and untreated p27^+/+ and p27^−/− MEFs was subjected to a ChIP assay using anti-c-Jun antibody (Ab). I.P., immunoprecipitation. G, the activation of HSF-1 was compared in the indicated cells in the cellular response to arsenite exposure. H, shown is a proposed model for p27 suppression of Hsp27 and Hsp70 expression upon arsenite exposure.