Direct transcriptional control of the Arabidopsis immune receptor FLS2 by the ethylene-dependent transcription factors EIN3 and EIL1

Abstract

In plant innate immunity, the leucine-rich repeat receptor kinase FLS2 recognizes the bacterial pathogen-associated molecular pattern (PAMP) flagellin. The molecular mechanisms underlying PAMP perception are not fully understood. Here, we reveal that the gaseous phytohormone ethylene is an integral part of PAMP-triggered immunity. Plants mutated in the key ethylene-signaling protein EIN2 are impaired in all FLS2-mediated responses, correlating with reduced FLS2 transcription and protein accumulation. The EIN3 and EIN3-like transcription factors, which depend on EIN2 activity for their accumulation, directly control FLS2 expression. Our results reveal a direct role for ethylene in regulation of an innate immune receptor.

Fig. 1.

A genetic screen for flagellin-insensitive (fin) mutants identified an ein2 allele. (A) Oxidative burst triggered by 100 nM flg22 in wild-type Col-0 and fin3 mutant plants measured in relative light units (RLU). Total ROS production (Inset) expressed as percentage of flg22-treated Col-0. Values are mean ± SE (n = 20). (B) Seedling growth inhibition triggered by flg22. Five-day-old wild-type Col-0 and fin3 seedlings were treated with 1 μM flg22 for 12 d. (Scale bar, 5 mm.) (C) Quantification of growth inhibition in wild-type Col-0 and fin3 seedlings treated with 1 μM flg22 for 12 d. Values are mean ± SE (n = 12). (D) Schematic representations of the EIN2 gene (At5g03280) and deduced protein with positions of the ein2-5 and fin3 mutations. Filled boxes and open boxes represent the 5′- and 3′-untranslated regions and exons of the gene, respectively. The ein2-5 deletion (CATGACT) is at position +1465 after start codon, and the fin3 deletion (AGACGTTGAAATGGCAATCTCTTGTAGAAAAGG) is at position +4280. The predicted transmembrane helices are shown as rectangles. Statistical significance by comparison with Col-0 was assessed using t test. ***P < 0.001. Similar results were observed in at least three independent experiments.

Fig. 2.

Ethylene signaling is required for flg22-induced responses. (A) Total ROS production triggered by 100 nM flg22 in Col-0, fin3, and ein2-5 mutants. Values are expressed as percentage of ROS obtained with Col-0 for 40 min and are mean ± SE (n = 20). (B) Callose deposition triggered in leaves 24 h after infiltration with water or 1 μM flg22 in Col-0, fin3, and ein2-5 plants. Results showing quantification of callose deposits (foci/mm⁻²) are mean ± SE (n = 4). For ein2-5, the same letter indicates statistically nonsignificant (one-way ANOVA; P > 0.05) differences between samples. (C) Activation profile of the MAP kinases MPK3 and MPK6 in response to treatment with water or 100 nM flg22 in Col-0, fin3, and ein2-5 mutants. Arrowheads indicate phosphorylated MPK6 and MPK3. Blots stained with colloidal Coomassie Blue (CCB) are presented to show equal loading. (D) Growth inhibition of Col-0, fin3, and ein2-5 seedlings treated with different concentrations of flg22 for 12 d. Values are mean ± SE (n = 12). (E) Growth of Pto DC3000 on Col-0, fls2, and ein2-5 plants pretreated with water or 1 μM flg22 for 24 h and then syringe-infiltrated with 10⁵ cfu/mL⁻¹ of bacteria. Bacterial growth was determined 2 d postinoculation. Values are mean ± SE (n = 8). Statistical significance by comparison with Col-0 was assessed using one-way ANOVA followed by Dunnett's test. *P < 0.05; **P < 0.01; ***P < 0.001. Similar results were observed in at least three independent experiments.

Fig. 3.

Endogenous ethylene signaling regulates FLS2 expression. (A) Western blot showing accumulation of FLS2 proteins in Col-0, ein2-5, and etr1-1 13-d-old seedlings. The fls2 mutant was used as a negative control for FLS2 detection. Thirty micrograms of total protein were loaded in each lane. Blots stained with CCB are presented to show equal loading. Similar results were observed in at least three independent experiments. (B) Quantitative RT-PCR analysis of FLS2 expression in Col-0, etr1-1, and ein2-5 untreated 13-d-old seedlings. Transcript levels are normalized to the U-box housekeeping gene At5g15400 and are presented as relative to untreated Col-0. Similar results were observed in at least three independent experiments. Statistical significance by comparison with untreated Col-0 was assessed using one-way ANOVA followed by Dunnett's test. ***P < 0.001.

Fig. 4.

EIN3/EIL1 directly control FLS2 expression at the transcriptional level. (A) Alignment of ChIP-Seq reads across the FLS2 (At5g46330) gene and promoter region as shown with Anno-J viewer. Col-0 or ein3-1 etiolated seedlings were grown in hydrocarbon-free air for 3 d, treated with 10 ppm ethylene gas for 4 h, and then used in ChIP-Seq analysis using an anti-EIN3 polyclonal antibody. The proximal and distal regions with significant enrichment are highlighted by red brackets and dashed lines. Results from two independent experiments are presented. Reads are normalized for each sample. Gene annotation is depicted at the top; filled boxes and open boxes represent the 5′- and 3′-untranslated regions and exons of the gene, respectively. (B) Enrichment of the indicated EIN3-associated DNA fragments after ChIP-PCR. Chromatin from wild-type Col-0 and ein3-1 light-grown seedlings was immunoprecipitated with an anti-EIN3 polyclonal antibody. Enrichment of associated DNA fragments was verified by qPCR using specific primers and is presented as relative to Col-0. (C) Sequence alignment of EIN3 binding sites in ERF1, EBF2, and FLS2 promoters. EIN3 binding sites in the promoters of ERF1 (23) and EBF2 (25) are presented. Identified by ChIP-Seq, the two potential binding sites of EIN3 to the FLS2 promoter are also shown. (D) Quantitative RT-PCR analysis of FLS2 expression in Col-0, ein2-5, ein3-1, eil1-1, and ein3-1 eil1-1 seedlings. Transcript levels are normalized to the U-box housekeeping gene and are presented as relative to Col-0. Data are representative of one of two experiments. (E) Total ROS production triggered by 100 nM flg22 in Col-0, ein2-5, ein3-1, eil1-1, and ein3-1 eil1-1 mutants. Values are expressed as percentage of ROS obtained with Col-0 for 40 min and are mean ± SE (n = 20). Statistical significance by comparison with (B) ein3-1 and (C) Col-0 was assessed using one-way ANOVA followed by Dunnett's test. *P < 0.05; **P < 0.01; ***P < 0.001. Similar results were observed in at least three independent experiments.