Leucine-rich repeat protein PRAME: expression, potential functions and clinical implications for leukaemia

Abstract

PRAME/MAPE/OIP4 is a germinal tissue-specific gene that is also expressed at high levels in haematological malignancies and solid tumours. The physiological functions of PRAME in normal and tumour cells are unknown, although a role in the regulation of retinoic acid signalling has been proposed. Sequence homology and structural predictions suggest that PRAME is related to the leucine-rich repeat (LRR) family of proteins, which have diverse functions. Here we review the current knowledge of the structure/function of PRAME and its relevance in leukaemia.

Figure 1

PRAME expression in leukaemia and lymphoma cell lines. A: Northern blot analysis of PRAME expression in leukaemia and lymphoma cell lines. Samples contained 50 μg of total RNA extracted from tumour cell lines. After Northern blotting, membranes were hybridised with a ³²P-labelled probe consisting of full-length PRAME coding region, washed at high stringency and visualised using a phosphorimager. A control probe (β-actin) was used to confirm equal loading. Both overnight and extended exposures are shown. B: Semi-quantitative RT-PCR analysis of PRAME and GAPDH expression in leukaemia and lymphoma cell lines. RNA was extracted and reversed transcribed using oligo(dT)_12-18. cDNA was amplified using primers: PRAME forward (5'atggaacgaaggcgtttg-3'), PRAME reverse (5'-ctagttaggcatgaaacaggg-3'), GAPDH forward (5'-aggtgaaggtcggagtcaac-3') and GAPDH reverse (5'-gatgacaagcttcccgttct-3'). An aliquot of the PCR reaction was removed after 36, 38 and 40 cycles for the PRAME reaction as indicated, or 35 cycles for the GAPDH control. PCR products were visualised by gel electrophoresis. C: Induced expression of PRAME in U937 after DNA demethylation. Leukaemia cell lines U937 (low levels of PRAME) and K562 (PRAME overexpressed) were cultured in RPMI plus 10% foetal bovine serum and treated with 1 μM 5-aza-2'-deoxycytidine for 0-72 hours. RNA was extracted and reverse transcribed for expression analysis. PRAME mRNA levels were quantified by real-time qPCR using the following primers: PRAME 254F (tgctgatgaagggacaacat), PRAME 364R (cagcacttgaagtttccacct). GAPDH primers were as in Fig. 1B. Fold increase in PRAME expression was calculated by the standard delta-delta CT method, relative to GAPDH.

Figure 2

PRAME LRR repeats, subcellular localisation and interaction with nuclear receptors. A: Predicted domain structure of the human PRAME sequence indicating potential Leucine Rich Repeats (LRRs). The LRRs are numbered and indicated by the blue arrows; residues conserved in typical LRRs are highlighted in bold. The black boxes indicate regions predicted to have a high probability of α-helicity, and two predicted NLS sequences are underlined. The boxed area in red is a region implicated in interaction with retinoic acid receptors, and potentially contains LXXLL and CoRNR box-like motifs. B: Subcellular localisation of endogenous PRAME proteins in leukaemia cell lines. Leukaemia cell lines were cultured as described in the legend to Fig. 1, and harvested onto coverslips using a cytospin centrifuge. Cells were fixed in 4% paraformaldehyde, permalised with 0.2% Triton X-100 and blocked with 3% PBS prior to application of an α-PRAME antibody (Abcam ab31285) followed by secondary antibody (Alexa Fluor 594 chicken anti-rabbit IgG - Invitrogen A21442). DNA was stained with a Hoechst stain (Sigma Aldrich 332581). Images were captured using LSM 510 Meta confocal laser scanning microscope (Zeiss). C: Yeast two-hybrid experiments to assess interactions of SRC1 nuclear receptor interaction domain (431-761) or full-length PRAME (1-509) with nuclear receptors were performed using the reporter strain S.cerevisiae L40 as described previously [68,69]. PRAME and SRC1 domains were expressed as LexA fusion proteins. Nuclear receptor ligand binding domains (RARα 200-464; RXRα 230-467; ERα 282-595; AR 625-919) were expressed as VP16 activation domain (411-490) fusion proteins, and reporter (β-galactosidase) specific activity was determined as described previously [68,69].

Figure 3

Potential nuclear and cytoplasmic functions of PRAME. Schematic representation depicting interactions of PRAME with nuclear proteins such as retinoic acid receptor (RAR), polycomb repressor EZH2 and the serine threonine kinase STK19. Interaction with RARs and EZH2 is thought to modulate gene expression and responses to retinoic acid signalling. PRAME also interacts with the outer membrane opacity protein (OPA-P) from bacterial pathogen N. gonorrhoea, and may also interact with other pathogen-associated microbial patterns (PAMPs) entering the cytoplasm. In addition, expression of PRAME in cancer cells may allow it to function in sensing molecules associated with cancer or cancer-related inflammation.