Rapid bacterial artificial chromosome modification for large-scale mouse transgenesis

Abstract

We report here a high-throughput method for the modification of bacterial artificial chromosomes (BACs) that uses a novel two-plasmid approach. In this protocol, a vector modified in our laboratory to hold an R6Kγ origin of replication and a marker recombination cassette is inserted into a BAC in a single recombination step. Temporal control of recombination is achieved through the use of a second plasmid, pSV1.RecA, which possesses a recombinase gene and a temperature-sensitive origin of replication. This highly efficient protocol has allowed us to successfully modify more than 2,000 BACs, from which over 1,000 BAC transgenic mice have been generated. A complete cycle from BAC choice to embryo implantation takes about 5 weeks. Marker genes introduced into the mice include EGFP and EGFP-L10a. All vectors used in this project can be obtained from us by request, and the EGFP reporter mice are available through the Mutant Mouse Regional Resource Center (NINDS/GENSAT collection). CNS anatomical expression maps of the mice are available to the public at http://www.gensat.org/.

Figure 1

A flowchart of the two-plasmid/one–recombination step approach to BAC modification. Transgenes held by pLD53.SC2 include EGFP and EGFP-L10a (EGPF-ribosomal fusion protein). A complete cycle from BAC selection to injection of the modified BAC takes ~5 weeks to complete.

Figure 2

A diagrammatic representation of the two-plasmid/one–recombination step BAC modification protocol. In this figure, the gene-specific A-homology arm has already been cloned into the EGFP-containing pLD53.SC2 (described in the protocol). Homologous recombination between pLD53.SC2/A-box and the BAC (a supercoiled circular structure that is represented as a line here) requires a recombinase supplied by pSV1.RecA. After recombination is complete, incubation of bacteria with chloramphenicol, ampicillin and tetracycline (chlor/amp/tet) results in the selection of bacteria that contain a correctly modified BAC. Free pLD53.SC2/A-box remaining in the BAC host bacteria will also be eliminated because of the lack of pi protein required for replication. A second incubation of the bacteria at 43 °C will result in the elimination of pSV1.RecA, as it cannot replicate at this temperature. The presence of the pLD53.SC2 sequence on the BAC does not interfere with the transgene expression or with viability in the animals generated. Confirmation of successful BAC modification as well as organism genotyping can be carried out by PCR amplification of the areas indicated by pink arrows, 5′ forward cointegrate (5′ FC) and 3′ reverse marker primers (3′ RM), and blue arrows, 5′ forward R6Kγ ori (5FR6) and 3′ reverse cointegrate (3′ RC) primers.

Figure 3

Diagrammatic representation of an A-homology (A-box) arm. The example chosen is the gene Chat (encoding choline acetyltransferase). The 5′ primer used in the amplification of the Chat A-box was 5′ GGCGCGCCAAGGTGCTCTAGTGCTCTGATCCCAG 3′. The first eight nucleotides in this sequence do not correspond to the genomic sequence of Chat but represent an added AscI recognition site sequence 5′-GGCGCGCC-3′. A key step in designing the 5′ primer is the addition of an AscI or MluI enzyme site at the front of the primer. It serves in a later step when the A-homology arm is ligated into an AscI and SwaI-digested pLD53.SC2 vector at its AscI or SwaI cloning sites. If an internal AscI recognition sequence is present within the homology sequence (can be checked with the DNASTAR program), a MluI recognition site, 5′-ACGCGT-3′, should be added to the end of the primer instead. The enzyme MluI is then used in the digestion step. The 3′ primer used for Chat in the homology amplification step was 5′ CCTAGCGATTCTTAATCCAGAGTAGC 3′. This is the reverse-complement of the 3′ sequence highlighted in the figure.

Figure 4

Confocal micrographs of direct epifluorescence captured from tissue sections from six GENSAT EGFP BAC transgenic mice that were generated using the protocol described in this paper. (a) Crym-expressing pyramidal neurons in the cerebral cortex of a P7 mouse. (b) Bnip3-expressing cells lining the intestine of an E15.5 mouse. (c) Id3-expressing glia and blood vessels. (d) Fluorescent fibers in the olfactory nerve layer of an adult Nrp1 mouse. (e) Fcer1g-expressing motor neurons and microglia in the medulla of a P7 mouse. (f) Igsf9-expressing progenitors in the dentate gyrus of the hippocampus. Expression is also seen in interneurons in the molecular layer. Bar in each panel represents 100 μm.

Figure 5

Ethidium bromide–stained agarose gel pattern showing digested pLD53SC2/A-box DNA from seven different genes. DNA was prepared from PCR-positive colonies, and then digested with AscI and XmaI. Samples were analyzed on a 1.5% agarose gel. The seven genes represented include Plekha2 (lane 1), Itgb5 (lane 2), Itga7 (lane 3), Tdo2 (lane 4), Trpc6 (lane 5), Slc39a6 (lane 6) and Sostdc1 (lane 7). The last sample is pLD53SC2 alone as a vector control (C). Fragment sizes were determined by comparison with a 2-log DNA ladder. The lower bands, which range from 395 to 515 bp, are inserts of each gene. The last sample is the vector that does not contain an insert. If the cloning does not work, the lane will contain a single 3,405-bp band representing the unmodified pLD53SC2.

Figure 6

Pulsed-field gel patterns of linearized modified BAC DNA. The DNA was digested and run on a 1% agarose pulse field gel at 16 °C in 0.5× TBE in a CHEF-DR III (Bio-Rad) system at 6 V cm⁻¹, with initial and final switch times of 5 and 20 s and an angle of 120° for 16 h. The gel was stained with 0.5 mg ml⁻¹ ethidium bromide for 1 h and was then destained in H₂O for 1 h. Fragment sizes were determined by comparison with a low-range PFG marker DNA ladder. Lane M: low-range (2.03–194 kb) PFG marker DNA ladder. The nine genes modified include Bsx (lanes 1 and 2), Gdf10 (lanes 3 and 4; very light band), Kcnip2 (lanes 5 and 6), Cmbl (lane 7), Cyp26b1 (lane 8), Plcxd2 (lane 9), Med12 (lane 10), Cx3cr1 (lane 11) and Fam102b (lane 12). The concentrations of our samples are determined by comparison with six DNA standards on the right side of the gel. The lanes, from left to right, represent 1, 2, 4, 8, 16, and 24 ng DNA.