Chromaffin progenitor cells from the adrenal medulla

Abstract

Chromaffin cells of the adrenal medulla are neural crest-derived cells of the sympathoadrenal lineage. Different lines of evidence suggest the existence of a subpopulation of proliferation-competent progenitor cells even in the adult state. The identification of sympathoadrenal progenitors in the adrenal would greatly enhance the understanding of adrenal physiology and their potential role in adrenal pathogenesis. Isolation and differentiation of these progenitor cells in culture would provide a tool to understand their development in vitro. Furthermore, due to the close relation to sympathetic neurons, these cells might provide an expandable source of cells for cell therapy in the treatment of neurodegenerative diseases. We therefore aim to establish protocols for the efficient isolation, enrichment and differentiation of chromaffin progenitor cells to dopaminergic neurons in culture.

Fig. 1

a Bovine chromosphere. Isolated primary chromaffin cells were cultured in Neurobasal medium containing 2% B27-Supplement (both Gibco, Grand Island, NY), 1% penicillin–streptomycin solution, 2 mM l-glutamine (PAA Laboratories, Cölbe, Germany), 20 ng/ml epidermal growth factor, 20 ng/ml bovine fibroblast growth factor (bFGF), and 10 ng/ml leukemia inhibitory factor (all Sigma–Aldrich, St. Louis, MO) in ultra low-attachment culture flasks where cells formed non-adherent spheroid clusters. A sphere is shown after 14 days of culturing; bar = 20 μm. b mRNA expression of Mash1 in bovine chromospheres cultured for 21 days (lane 3) as compared to freshly isolated differentiated chromaffin cells (lane 2). GAPDH expression served as loading control. RT–PCR reaction was carried out with initial denaturation at 94°C for 4 min; 25–35 cycles amplification at 94°C for 20 s, annealing for 20 s at 60°C (Mash1) or 62°C (GAPDH), and elongation at 72°C for 20 s, followed by final extension at 72°C for 4 min. Lane 1: water control. Primer Sequences: Mash1 forward CCCAACTACTCCAACGACATGAACT, Mash1 reverse GAGAAAGCACTGAAGATGCAGGTTG; GAPDH forward AGCCGCATCCCTGAGACAAG, GAPDH reverse CTGCCTTGACTGTGCCGTTG. c Differentiation of chromosphere cells. Bovine chromaffin precursors differentiated into β III tubulin⁺ neurons (red) and counterstained with DAPI. Bovine chromaffin cells were cultured in low-attachment conditions for 7 days while they formed spheroid clusters-chromospheres (CS). Prior to differentiation, CS were disassociated to single cell and seeded onto glass cover slips coated with poly-l-lysine (4 μg/ml)/laminin (5 μg/ml). Then, differentiation of chromaffin cells was induced by 7 days cultivation in DMEM/F12 medium (5 mM HEPES, 1% penicillin–streptomycin solution, 2 mM l-glutamine, 7.5% sodium bicarbonate, 5 μg/ml heparin, 5 μM retinoic acid, and 10 μM ascorbic acid) supplemented with 1% N2-Supplement and 20 ng/ml bFGF. Cells were allowed to differentiate for further 5 days in differentiation medium DMEM/F12 medium supplemented with 2% B27 supplement and 20 ng/ml EGF. Neurons were identified with rabbit polyclonal antibodies against β III tubulin (1:4000) which was labelled with a secondary goat anti rabbit IgG conjugated with Cy2 (1:500). Slides were examined by fluorescence microscopy (Zeiss LSM 405/595 nm Meta confocal microscope, Carl Zeiss, Jena Germany). Bar = 10 μm