Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes

Abstract

Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5' CCCGAATTCGGG 3', (2) by a 22-bp related sequence 5' CTCGTGCCGAATTCGGCACGAG 3', and (3) by a longer 44-bp related sequence: 5' CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3'. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (-) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5' G/AATTC 3', its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations.

FIG. 1.

Microarray results of sequences including contaminating adaptor fragments, in a human gene (A), and in a mouse gene (B); for comparison, a related contaminant found in rat (C) is presented; similar to “the EcoRI site (GAATTC) deleted” described by Yoshikawa et al., . >70 additional examples with the palindromic contaminant taken from the Affymetrix microarrays can be found at www.reocities.com/plin9k/affy70.zip. The drop of microarray expression to zero in (A), (B), and (C) demonstrates the absence of palindromic linkers or adaptors in the analyzed tissues (images stored by the author at www.iscid.org/papers/Chavez_Palindromati_101505.pdf). In (D) and (E) we see the BLAST analysis of sequence L21934.2 or HUMACYLCOA corresponding to the heterogeneous ACAT1 reported by Li et al. (1999). The gap on the sequences below and above it indicates the absence of exon Xb (Li et al., 1999) in ACAT1 human sequences reported by other groups. (D) Sequences present in the Human genomic plus transcript database: (D-1) Chr. 7 genomic contig, GRCh37 (NT_007933.15), (D-2) Chr. 7 genomic contig, alternate assembly by HuRef (NW_001839071.2), (D-3) Sterol O-acyltransferase 1 (SOAT1), transcript variant 688113 (NM_003101.4), (D-4) Chr. 1 genomic contig, GRCh37 (NT_004487.19), (D-5) Chr. 1 genomic contig, alternate assembly by HuRef (NW_001838533.2). (E) Sequences present in the Nucleotide collection (nr/nt) database: (E-1) HUMACYLCOA H. sapiens acyl-coenzyme A: cholesterol acyltransferase (L21934.2), (E-2) H. sapiens PAC clone RP4-797C5 from Chr. 7 (AC004888.1), (E-3) Pan troglodytes BAC clone CH251-572C18 from Chr. 7 (AC187744.3), (E-4) Pan troglodytes BAC clone RP43-28H17 from Chr. 7 (AC146259.4), (E-5) Pan troglodytes sterol O-acyltransferase 1, variant 2 (SOAT1) predicted (XM_514030.2), (E-6) H. sapiens cDNA: FLJ22958 fis, clone KAT09975, similar to HUMACYLCOA (AK026611.1), (E-7) H. sapiens sterol O-acyltransferase 1 (SOAT1), transcript variant 688113 (NM_003101.4, BC028940.1). (F) Partial self-annealing proposed by UNAFold for the 44-bp EcoRI contaminating palindrome, (G) Self-annealing of the 22-bp contaminant and in (H–J), of the 12-bp contaminants and/or synthetic palindromes. ACAT1, acyl-CoA:cholesterol acyltransferase-1.

FIG. 2.

Representation of the lack of digestion by EcoRI: (A) The DNA restriction site where each monomer of the EcoRI dimer properly cuts: 5′- G/AATTC 3′. Lack of digestion of the single-strand self-annealed contaminating palindromes derived from the EcoRI linker ZAP adaptor: (B) the contaminated human ACAT1 L21934 (Li et al., 1999), a sequence that includes exon Xb (5′ CCGAATTCGG 3′). (C) Single-strand self-hybridizations of a 22-bp palindromati found in human phosphatase 1, catalytic subunit α cDNA, clone BC004482.2 (Strausberg et al., 2002). (D) Single-strand self-hybridizations of a 44-bp palindromati found in the alcohol dehydrogenase 7 (ADH7) cDNA AF195867.1 of Vitis vinifera (Or et al., 2000), its 5′ GA tandem also seems to be a contaminant.