Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
. 2011 Jul;34(3):416-20.
doi: 10.1590/S1415-47572011000300008. Epub 2011 Jul 1.

Genotype-phenotype correlation in cystic fibrosis patients bearing [H939R;H949L] allele

Affiliations

Genotype-phenotype correlation in cystic fibrosis patients bearing [H939R;H949L] allele

Angela Polizzi et al. Genet Mol Biol. 2011 Jul.

Abstract

Cystic fibrosis (CF) is caused by CFTR (cystic fibrosis transmembrane conductance regulator) gene mutations. We ascertained five patients with a novel complex CFTR allele, with two mutations, H939R and H949L, inherited in cis in the same exon of CFTR gene, and one different mutation per patient inherited in trans in a wide population of 289 Caucasian CF subjects from South Italy. The genotype-phenotype relationship in patients bearing this complex allele was investigated. The two associated mutations were related to classical severe CF phenotypes.

Keywords: CFTR; complex allele; cystic fibrosis; phenotype.

PubMed Disclaimer

Figures

Figure 1
Figure 1
Sequence electropherograms showing the complex allele [H939R;H949L] in CFTR exon 15, (A) forward and (B) reverse (Forward primer: TCAGTAAGTAACTTTGGCTGC; Reverse primer: CCTATTGATGGTGGATCAGC). Continuous arrows show the H939R mutation while the dashed arrows show the H949L mutation.

References

    1. Abramowicz MJ, Dessars B, Sevens C, Goossens M, Girodon-Boulandet E. Fetal bowel hyperechogenicity may indicate mild atypical cystic fibrosis: A case associated with a complex CFTR allele. J Med Genet. 2000;37:E15. - PMC - PubMed
    1. Bompadre SG, Sohma Y, Li M, Hwang TC. G551D and G1349D, two CF-associated mutations in the signature sequences of CFTR, exhibit distinct gating defects. J Gen Physiol. 2007;129:285–298. - PMC - PubMed
    1. Boyle MP. Non classic cystic fibrosis and CFTR-related diseases. Curr Opin Pulm Med. 2003;9:498–503. - PubMed
    1. Brett MM, Simmonds EJ, Ghonheim ATM, Littlewood JM. The value of serum IgG titres against Pseudomonas aeruginosa in the management of early infection in cystic fibrosis. Arch Dis Child. 1992;67:1086–1088. - PMC - PubMed
    1. Brugnon F, Bilan F, Heraud MC, Grizard C, Janny L, Creveaux I. Outcome of intracytoplasmic sperm injection for a couple in which the man is carrier of [R74W;V201M;D1270N] and P841N mutations and his spouse a heterozygous carrier of F508del mutation of CFTR gene. Fertil Steril. 2004;90:23–26. - PubMed

Internet Resources

    1. Cystid Fibrosis Mutation Database: http://www.genet.sickkids.on.ca/cftr (July 7, 2010).