The food additive vanillic acid controls transgene expression in mammalian cells and mice

Abstract

Trigger-inducible transcription-control devices that reversibly fine-tune transgene expression in response to molecular cues have significantly advanced the rational reprogramming of mammalian cells. When designed for use in future gene- and cell-based therapies the trigger molecules have to be carefully chosen in order to provide maximum specificity, minimal side-effects and optimal pharmacokinetics in a mammalian organism. Capitalizing on control components that enable Caulobacter crescentus to metabolize vanillic acid originating from lignin degradation that occurs in its oligotrophic freshwater habitat, we have designed synthetic devices that specifically adjust transgene expression in mammalian cells when exposed to vanillic acid. Even in mice transgene expression was robust, precise and tunable in response to vanillic acid. As a licensed food additive that is regularly consumed by humans via flavoured convenience food and specific fresh vegetable and fruits, vanillic acid can be considered as a safe trigger molecule that could be used for diet-controlled transgene expression in future gene- and cell-based therapies.

Figure 1.

Design and validation of the VAC_ON and VAC_OFF systems. (A and B) Diagram and functionality of the VAC_ON system. (A) VanR was fused to the KRAB transrepressor domain, a human Krueppel-associated box protein, resulting in VanA₄ (VanR-KRAB), which was expressed by the constitutive human cytomegalovirus immediate early promoter (P_hCMV) (pCK189). The vanillic acid-inducible promoter P_VanON8 harbors eight VanO operator sites immediately 3′ of a constitutive Simian virus 40 promoter (P_SV40) that was set to drive the human placental secreted alkaline phosphatase (SEAP) (pCK191). OFF status: VanA₄ is constitutively expressed and, in the absence of vanillic acid (–VAC), binds to P_VanON8 and represses SEAP expression. ON status: in the presence of vanillic acid (+VAC), VanA₄ is released from P_VanON8 which fully induces SEAP expression. (B) CHO-K1 cells were transiently transfected with pCK189 (P_SV40-VanA₄-pA) and pCK191 (P_VanON8-SEAP-pA) and SEAP-expression profiles were assessed 48 h after cultivation of the cells in medium containing different concentrations of vanillic acid (0–250 μM). (C and D) Diagram and functionality of the VAC_OFF system. (C) VanR was fused to the VP16 transactivation domain of the Herpes simplex virus, resulting in VanA₁ (VanR-VP16), which was expressed by the constitutive Simian virus 40 promoter (P_SV40) (pMG250). The vanillic acid-responsive promoter P_1VanO2 contains two VanO operator sites (ATTGGATCCAATAGCGCTATTGGATCCAAT; VanR binding sites in italics) immediately 5′ of a minimal human cytomegalovirus immediate-early promoter (P_hCMVmin), which was set to drive the human placental secreted alkaline phosphatase (SEAP) (pMG252). ON status: VanA₁ is constitutively expressed and, in the absence of vanillic acid (–VAC), binds to P_1VanO2 and activates SEAP expression. OFF status: in the presence of vanillic acid (+VAC), VanA₁ is released from P_1VanO2 which shuts down SEAP expression. (D) CHO-K1 cells were transiently transfected with pMG250 (P_SV40-VanA₁-pA) and pMG252 (P_1VanO2-SEAP-pA) and SEAP-expression profiles were assessed 48 h after cultivation of the cells in medium containing different concentrations of vanillic acid (0–250 μM).

Figure 2.

Validation of vanillic acid-responsive promoter variants containing different numbers of VanO operator modules. Vectors encoding SEAP expression driven by a vanillic acid-responsive promoter harbouring monomeric (pMG262), dimeric (pMG252), trimeric (pMG263) or tetrameric (pMG264) operator modules were co-transfected with pMG250 (P_SV40-VanA₁-pA) into (A) CHO-K1, (B) HEK-293 and (C) BHK-21 cells and SEAP production was scored after cultivation for 48 h in the presence and absence 250 µM vanillic acid.

Figure 3.

Combinatorial validation of the VAC_OFF system in different transactivator and promoter configurations. VAC_OFF transactivators employing different transactivation domains (A: VanA₁, VanR-VP16; pMG250) (B: VanA₂, VanR-p65; pMG256) (C: VanA₃, VanR-E2F4; pMG257) were co-transfected with different vanillic acid-responsive promoter variants containing 0 (P_1VanO2; pMG252), 2 (P_2VanO2; pMG265), 4 (P_3VanO2; pMG266), 6 (P_4VanO2; pMG267), 8 (P_5VanO2; pMG268) and 10 (P_6VanO2; pMG269) base-pair linkers between VanO and the minimal promoter into CHO-K1 cells. All promoter variants drove SEAP expression and the production was profiled 48 h after cultivation of the cells in media containing different concentrations of vanillic acid (0, 50 and 250 μM).

Figure 4.

Characterization of stably transgenic vanillic acid-responsive CHO-K1 cell lines. CHO-K1 was stably co-transfected with pMG250 (P_SV40-VanA₁-pA) and pMG252 (P_1VanO2-SEAP-pA) and vanillic acid-responsive SEAP expression of the resulting CHO-VAC cell lines was analysed. (A) After clonal expansion, individual clones were assessed for their vanillic acid-responsive regulation performance. SEAP levels were profiled after cultivation for 48 h in the presence and absence of vanillic acid (± VAC). (B) The dose–response profile of CHO-VAC₁₂ was profiled after cultivation for 48 h in medium containing increasing concentrations of vanillic acid (0–500 μM). (C) SEAP expression kinetics of CHO-VAC₁₂ cultivated for 72 h in the presence and absence of 250 μM vanillic acid (± VAC). (D) Reversibility of vanillic acid-responsive transgene expression following periodic addition and removal of the inducer. CHO-VAC₁₂ (80 000 cells/ml) were cultivated for 144 h in the presence and absence of 250 μM vanillic acid (± VAC). Every 48 h, the cell density was re-adjusted to 80 000 cells/ml and the cells were cultivated in fresh medium with reversed vanillic acid concentrations.

Figure 5.

Vanillic acid-controlled SEAP expression in mice. (A) CHO-VAC₁₂ cells were microencapsulated in alginate-poly-(l-lysine)-alginate beads and implanted intraperitoneally into female OF1 mice (4 × 10⁶ cells per mouse). The implanted mice received different concentrations of vanillic acid twice daily. Seventy-two hours after implantation, the level of SEAP in the serum of the mice was determined. Data represent mean ± SEM of 8 mice per treatment group. (B) SEAP expression profiles of the microencapsulated CHO-VAC₁₂ implant batch were cultivated in vitro for 72 h at different vanillic acid concentrations. (C and D) Extracts of wild-type mouse organs were assessed for their vanillic acid content based on their ability to induce the (C) VAC_OFF or (D) VAC_ON systems. Vanillic acid-spiked organs were used as positive control. All samples were compared to the effect of 250 μM vanillic acid to show the fully induced state of the systems. All extracts were added to CHO-K1 cells transiently transfected with either the VAC_ON or the VAC_OFF systems and SEAP expression was assessed after a cultivation period of 48 h.