Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
Case Reports
. 2012 May;157(4):507-10.
doi: 10.1111/j.1365-2141.2012.09039.x. Epub 2012 Feb 2.

Imatinib resistant BCR-ABL1 mutations at relapse in children with Ph+ ALL: a Children's Oncology Group (COG) study

Bill H Chang, Stephanie G Willis, Linda Stork, Stephen P Hunger, William L Carroll, Bruce M Camitta, Naomi J Winick, Brian J Druker, Kirk R Schultz
Case Reports

Imatinib resistant BCR-ABL1 mutations at relapse in children with Ph+ ALL: a Children's Oncology Group (COG) study

Bill H Chang et al. Br J Haematol. 2012 May.
No abstract available

PubMed Disclaimer

Conflict of interest statement

Conflict of Interest:

BHC, SGW, LS, WLC, BMC, NJW and KRS have no competing financial interests. SPH is a member of the Bristol Myers Squibb Dasatinib Pediatric Advisory Committee (without compensation). His children own stock in Bristol Myers Squibb. B.J.D. has financial interest in MolecularMD and receives clinical trial funding from Novartis and Bristol Myers Squibb.

Figures

Figure 1
Figure 1. Sequence chromatogram of case
a. Sequence results from the presented case at diagnosis and relapse. Briefly, patient total RNA was isolated from mononuclear cells and cDNA was synthesized with random hexamers using Superscript III (Invitrogen, Grand Island, NY, USA). Patient cDNA (1-μl) was PCR amplified using B2A forward (TTCAGAAGCTTCTCCCTGACAT) and ABL1 4317 reverse (AGC TCT CCT GGA GGT CCT C) in a 20-μl reaction (Table 1). PCR product (1-μl) was used as template in the second round (nested) 50-μl reaction with BCR F4 forward (ACAGCATTCCGCTGACCATCAATA) and ABL1 4307 reverse (GAGGTCCTCGTCTTGGTGG) primers. All PCR reactions were performed with Accuprime TAQ, (Invitrogen) and 20 pmol of each primer. Resulting PCR products were sequenced with 2 forward and 2 reverse sequencing primers. Sequences were aligned with Sequencher (Gene Codes, Ann Arbor, MI, USA) sequence analysis program. b. Sequence results from case #9 from bone marrow samples from diagnosis and relapse.
See this image and copyright information in PMC

References

    1. Arico M, Schrappe M, Hunger SP, Carroll WL, Conter V, Galimberti S, Manabe A, Saha V, Baruchel A, Vettenranta K, Horibe K, Benoit Y, Pieters R, Escherich G, Silverman LB, Pui CH, Valsecchi MG. Clinical outcome of children with newly diagnosed Philadelphia chromosome-positive acute lymphoblastic leukemia treated between 1995 and 2005. J Clin Oncol. 2010;28:4755–4761. - PMC - PubMed
    1. Boulos N, Mulder HL, Calabrese CR, Morrison JB, Rehg JE, Relling MV, Sherr CJ, Williams RT. Chemotherapeutic agents circumvent emergence of dasatinib-resistant BCR-ABL kinase mutations in a precise mouse model of Philadelphia chromosome-positive acute lymphoblastic leukemia. Blood. 2011;117:3585–3595. - PMC - PubMed
    1. Druker B, Sawyers C, Kantarjian H, Resta D, Reese S, Ford J, Capdeville R, Talpaz M. Activity of a specific inhibitor of the BCR-ABL tyrosine kinase in the blast crisis of chronic myeloid leukemia and acute lymphoblastic leukemia with the philadelphia chromosome. The New England Journal of Medicine. 2001;344:1038–1042. - PubMed
    1. Hu Y, Liu Y, Pelletier S. Requirement of Src kinases Lyn, Hck, and Fgr for BCR-ABL 1-induced B-lymphoblastic leukemia but not chronic myeloid leukemia. Nat Genet. 2004;36:453–461. - PubMed
    1. Jones D, Thomas D, Yin CC, O’Brien S, Cortes JE, Jabbour E, Breeden M, Giles FJ, Zhao W, Kantarjian HM. Kinase domain point mutations in Philadelphia chromosome-positive acute lymphoblastic leukemia emerge after therapy with BCR-ABL kinase inhibitors. Cancer. 2008;113:985–994. - PMC - PubMed

MeSH terms