Poly(ADP-ribose) controls DE-cadherin-dependent stem cell maintenance and oocyte localization

Abstract

Within the short span of the cell cycle, poly(ADP-ribose) (pADPr) can be rapidly produced by poly(ADP-ribose) polymerases and degraded by poly(ADP-ribose) glycohydrolases. Here we show that changes in association between pADPr and heterogeneous nuclear ribonucleoproteins (hnRNPs) regulate germline stem cell (GSC) maintenance and egg chamber polarity during oogenesis in Drosophila. The association of pADPr and Hrp38, an orthologue of human hnRNPA1, disrupts the interaction of Hrp38 with the 5'-untranslated region of DE-cadherin messenger RNA, thereby diminishing DE-cadherin translation in progenitor cells. Following the reduction of DE-cadherin level, GSCs leave the stem cell niche and differentiate. Defects in either pADPr catabolism or Hrp38 function cause a decrease in DE-cadherin translation, leading to a loss of GSCs and mislocalization of oocytes in the ovary. Taken together, our findings suggest that Hrp38 and its association with pADPr control GSC self-renewal and oocyte localization by regulating DE-cadherin translation.

Figure 1. pADPr accumulates in mitotic germline stem cell and cystoblast

(a) The comparison of total cellular pADPr level in different tissues of Drosophila adult by Western blotting. The total protein from different tissues was immunoblotted with anti-pADPr antibody. The same blot was stripped and detected with anti-H3 antibody for loading control. i: intestines ; h: heads; fb: fat bodies; sg: salivary glands; fc: female carcasses; o: ovaries; mc: male carcasses; t: testes. (b) Schematic illustration of anterior part of Drosophila ovariole (matching c and d panels). Cap cells (blue) form germline stem cell (GSC) niche. CB: cystoblast; Ch1,Ch2: egg chambers 1 and 2. Germline cells are shown in green. Nuclei are shown in red. (c–f) Incorporation of the biotinylated NAD (bNAD) into in vitro-cultured Drosophila ovary. bNAD was detected using Avidin-Rhodamine staining (green). DNA was detected using oligreen dye (red). Strong accumulation of bNAD within dividing germline stem cell (GSC) (arrow), cystoblast (CB) (arrow) and in maturating germline cysts. c. Germarium and egg chamber 1. d. Germarium and egg chamber 1 (only bNAD is shown). (e, f) Egg chamber stages 4 (e) and 10 (f). O: oocyte; N: nurse cells; FC: follicle cells. Arrowhead indicates follicle cell in mitosis.

Figure 2. Parg expression in the ovary and mislocalization of the oocyte caused by Parg mutant clones

The anterior pole of all egg chambers is to the left, and the posterior pole is to the right. (a) Parg mRNA expression in the ovary of the wild type (y,w) detected by RNA in situ hybridization using Parg antisense probe. (b) The control of RNA in situ hybridization using Parg sense probe. (c) The expression of PARG-EGFP in the ovary induced by germline-specific GAL4 drivers. (d) The mock wild-type clones, including germline and polar follicle cells, showing the normal localization of the oocyte in the posterior. The oocyte is labeled with anti-orb antibody (red). The clones are generated from the female adults (FRT101/FRT101, ubi-GFP; FLP38/+) after heat shock. (e) Parg mutant germline clones showing the normal localization of the oocyte in the posterior. The germline clones are generated from the female adults (Parg^27.1, FRT101/FRT101, ubi-GFP; hs-FLP38/+) after heat shock. Parg mutant germline clones are shown by the absence of GFP expression (green); F-actin is stained with phalloidin to visualize the cell membrane, and the oocyte is labeled with anti-orb antibody (blue). (f) Parg mutant follicle cell clones showing the normal localization of the oocyte in the posterior. The follicle cell clones are generated from the female adults (Parg^27.1, FRT101/FRT101, ubi-GFP; en-Gal4,UAS-FLP38/+). Parg mutant follicle cell clones are shown by the absence of GFP expression (green). F-actin is stained with phalloidin to visualize the cell membrane. Arrow indicates the oocyte shown by the enrichment of F-actin in the ring canal. (g) Parg mutant germline and follicle cell clones in the anterior (white arrow). (h) Parg mutant clones, including germline and follicle cells, showing mislocalization of the oocyte in the lateral (red arrow). (g,h) Parg mutant germline and follicle cell clones are generated from the female adults (Parg^27.1,FRT101/FRT101,ubi-GFP; hs-FLP38/+) after heat shock and shown by the absence of GFP expression (green), and the oocyte is labeled with anti-orb antibody (red).

Figure 3. Ovary developmental defects caused by thehrp38 mutations

(a–e) Egg chambers stained with phalloidin to visualize filamentous actin in the cell membrane and anti-orb antibody to label the oocyte. The anterior pole of all the egg chambers is to the left, and the posterior pole is to the right. (a) The Hrp38:GFP expression pattern in the germarium. Arrows indicate the pre-oocytes in region 2b and the oocyte in region 3. (b) The Hrp38:GFP expression pattern in the stage 2, 3 and 5 egg chambers. (c) The wild type in which the oocyte is localized in the posterior pole. The egg chambers were stained with anti-FasIII (red) for labeling the polar cells. (d) The hrp38 hemizygotes showing the fused egg chambers. The egg chambers stained with Drag-5 (blue) to visualize DNA. (e) The hrp38 hemizygotes showing mislocalization of the oocytes. Arrows indicate the separated polar cells stained with anti-FasIII (red) in the lateral where the oocyte is localized in the stage 5 egg chamber. (f) and (g) Gurken protein localization in the oocyte of the wild type (f) and the hrp38 mutant (g).

Figure 4. Regulation of DE-cadherin expression by pADPr modification of Hrp38

The anterior pole of all the egg chambers is to the left, and the posterior pole is to the right. (a) DE-cadherin expression in the egg chamber of the wild type. (b) DE-cadherin expression in the egg chambers of the hrp38 mutant. The oocytes were labeled with anti-orb antibody. In (a, b), green arrow indicates the interface between oocyte and anterior follicle cells (polar cells), and yellow arrow indicates the adherens junctions between the lateral follicle cells. (c) DE-cadherin expression in Parg follicle cell clones. Parg mutant follicle cell clones are shown by the absence of GFP expression. (d) DE-cadherin expression in the wild-type (green arrow) and Parg follicle cell clones (white arrow) as in (c). Arrows in (c,d) indicate the adherens junctions between the lateral follicle cells. (e) DE-cadherin expression in Parg germline and follicle cell clones. Parg mutant germline and follicle cell clones are shown by the absence of GFP expression (green). Green arrow indicates the interface between germline cells and posterior follicle cells, and yellow arrow indicates the adherens junctions between the lateral follicle cells. (f) DE-cadherin expression in the egg chambers of the genotype (Parg−/+; hrp38^d05172/Df). The oocyte (white arrow) is labeled with anti-orb antibody. (g, h) Expression of DE-cadherin in the germline rescued oocyte mislocalization in Parg mutant clones. The full genotype is (Parg ^27.1, FRT101/Ubi-GFP, FRT101; FLP38/Nos-Gal4; UASp-DEcadherin/+). (g) The elevated DE-cadherin expression (white arrow) in the posterior pole of one egg chamber with the Parg mutant germline and follicle cell clones, including the polar cells. (h) The normal oocyte localization (white arrow) in the same egg chamber as (g). The oocyte is labeled with anti-orb antibody (red).

Figure 5. The hrp38 gene is required for maintenance of germline stem cells (GSC)

(a) Simplified diagram of the germarium structure. GSCs having the round spectrosome are localized in the niche containing terminal filament (TF) and cap cells. The cystoblast and its progeny are interconnected through the ring canals. (b) The hrp38 expression in GSC and cap cells in the tip of germarium of the Hrp38:GFP strain. GSC is labeled with anti-hts antibody for spectrosome (red). (c) 10-day-old germarial tip of the wild type. (d) 10-day-old germarial tip of the hrp38 mutant. In (c) and (d), GSCs are labeled with anti-hts (green) and anti-Vasa antibody (red). The cap cells are labeled with anti-Lam-C antibody (green). (e) 17-day-old germarium of the hrp38 mutant showing the last egg chamber. The fusome in the last egg chamber is shown as yellow after labeling with anti-hts (green) and anti-Vasa antibody (red). Arrow indicates an empty germarium. (f) Graph showing GSC maintenance rate of the indicated genotypes. The GSC maintenance rate was based on the percent of the germaria with 2–3 GSCs at the indicated time after eclosion. Two germaria with one GSC was counted as one wild-type germarium to calculate their maintenance rate. Symbols: dark blue line with diamonds (the wild type) (n=85); pink line with squares ( hrp38−/−) (n=82 ); black line with triangles (Parg+/−; hrp38−/−) (n=80 ); light blue with crosses (RFP:Hrp38/nos-Gal4; hrp38−/−) (n=92); dark magenta line with stars (DE-cad/nos-Gal4; hrp38−/−) (n=110). The error bar represents the standard deviation of the proportion normalized with the sample size. ** P<0.01, analysed by t-test. (g) DE-cadherin expression in the 10-day-old GSC in the wild type. (h) DE-cadherin expression in the 10-day-old GSCs in the hrp38 mutant. In (g) and (h), GSCs are labeled with anti-hts (green). Inserts showed DE-cadherin expression in the interface (arrows) between GSC and the cap cells (circled).

Figure 6. Loss of DE-cadherin expression in Parg mutant GSC

(a) Parg mRNA expression in GSC in the wild type (y,w), as detected by RNA in situ hybridization using Parg antisense probe. (b) The expression of PARG-EGFP in GSCs by germline-specific GAL4 drivers. (c) Germaria showing a 3-day-old Parg mutant GSC with loss of GFP expression. GSC is labeled with anti-hts (red). (d) 17-day-old germarium showing the loss of Parg mutant GSC. The loss of Parg mutant GSC was shown by the presence of two mutant egg chambers. GSC labeled with anti-hts antibody (red). (e,f) DE-cadherin expression in a germarium tip carrying one wild-type GSC and one Parg mutant GSC one week after clone induction. White cycle: the wild-type GSC (GFP positive); Red cycle: Parg mutant GSC (GFP-negative); GSCs are labeled with anti-hts antibody in (e). Insert in (f) shows DE-cadherin expression in the interface between GSCs and wild-type cap cells (arrow indicated in f). (g) 17-day-old germarium showing Parg mutant GSC and its progeny. (h) Expression of DE-cadherin in the germline cells rescued Parg mutant GSC loss as shown in (g). The full genotype (g and h): Parg ^27.1, FRT101/Ubi-GFP, FRT101; FLP38/Nos-Gal4; UASp-DEcadherin/+. GSC labeled with anti-hts antibody (blue). Arrows in (g and h) indicate DE-cadherin expression in the interface between GSCs and wild-type cap cells.

Figure 7. pADPr disrupts Hrp38 binding to 5′UTR of DE-cadherin conferring IRES activity

(a) The mRNA expression level of DE-cadherin in the different genotypes at the wandering third-instar larvae stage. (b) The protein expression level of DE-cadherin in the different genotypes at the wandering third-instar larvae stage. (c) The structure of DE-cadherin transcript. The biotin-labeled probes were made from three regions (5′UTR, coding region and 3′UTR). (d) Hrp38 binding to 5′UTR of DE-cadherin in the ovary is shown by UV-crosslinking analysis. The ovarian lysate from the wild-type fly (y,w) crosslinked to the biotin-labeled RNA probes as indicated was IPed with rabbit anti-Hrp38 antibody or normal rabbit IgG as the control for IP. The supernatant (S/N), which was obtained after each IP, was run in the same blot to show the efficiency of RNase treatment. (e) Decreased amounts of Hrp38 protein binding to 5′UTR of DE-cadherin in the Parg mutant. In (d,e) Hrp38 protein binding to biotin-labeled RNA probe was detected with Streptavidin. The same blot was stripped and probed with anti-Hrp38 antibody to show IP efficiency. (f) Inhibition of Hrp38 binding to its target RNA motif by poly(ADP-ribose). The biotin-labeled G-rich RNA element (CAGGGCGCGCACUGUACGAG) within 5′UTR of DE-cadherin was incubated with the components as indicated. (g) Diagrams of the different constructs for dual luciferase assay. pNO-IRES (negtative control); pPolio-IRES (positive control); pDEcad 5′UTR: DE-cadherin 5′UTR cloned into the vector in the forward orientation. pDEcad 5′UTR-reverse (spacer control); pDEcad-3′UTR (element control). (h) The ratio of firefly-to-renilla luciferase activity after the transfection of the different constructs as indicated into Drosophila S2 cells. (i–j) The association of Hrp38 with the transcript from pDEcad 5′UTR-luciferase construct shown by regular RT-PCR (i) and qRT-PCR (j) after RNA-IP. RNA IP was done using anti-Hrp38 antibody or rabbit IgG as a control after the transfection of pDEcad-5′UTR construct into S2 cells. The error bars in (h,j) represents the standard deviation from three independent experiments. **P ≤ 0.01, analyzed by t-test.

Figure 8. Diagram illustrating how Hrp38 modification by pADPr controls maintenance of GSC and oocyte localization

(a) pADPr binding to Hrp38 regulates DE-cadherin translation. Hrp38 binds to 5′UTR of DE-cadherin to promote translation by IRES-mediated manner. Once Hrp38 is modified with pADPr and dissociated from 5′UTR of DE-cadherin, its translation is inhibited. (b) pADPr modification of Hrp38 regulates DE-cadherin translation for germ-line stem cell (GSC) maintenance. DE-cadherin (red) accumulates in the interface between cap cells and GSC, keeping GSC in the stem cell niche. High level of pADPr (green) during mitosis and in cystoblasts suppresses translation of DE-cadherin. Suppression of DE-cadherin production promotes cystoblasts to leave stem cell niche and differentiate. (c) pADPr binding to Hrp38 regulates DE-cadherin translation for oocyte (OO) localization in maturating egg chamber. Low level of pADPr in the oocyte and mitotically quiescent polar cells (PC) allows translating DE-cadherin (red) and positioning the oocyte in the posterior pole of the egg chamber. High level of pADPr (green) in nurse cells and mid-body follicle cells inhibits translation of DE-cadherin. FC - follicle cells.