Brain responses to high-protein diets

Abstract

Proteins are suspected to have a greater satiating effect than the other 2 macronutrients. After protein consumption, peptide hormones released from the gastrointestinal tract (mainly anorexigenic gut peptides such as cholecystokinin, glucagon peptide 1, and peptide YY) communicate information about the energy status to the brain. These hormones and vagal afferents control food intake by acting on brain regions involved in energy homeostasis such as the brainstem and the hypothalamus. In fact, a high-protein diet leads to greater activation than a normal-protein diet in the nucleus tractus solitarius and in the arcuate nucleus. More specifically, neural mechanisms triggered particularly by leucine consumption involve 2 cellular energy sensors: the mammalian target of rapamycin and AMP-activated protein kinase. In addition, reward and motivation aspects of eating behavior, controlled mainly by neurons present in limbic regions, play an important role in the reduced hedonic response of a high-protein diet. This review examines how metabolic signals emanating from the gastrointestinal tract after protein ingestion target the brain to control feeding, energy expenditure, and hormones. Understanding the functional roles of brain areas involved in the satiating effect of proteins and their interactions will demonstrate how homeostasis and reward are integrated with the signals from peripheral organs after protein consumption.

Figure 1

A high-protein diet decreases energy intake without conditioned taste aversion in the rat. Daily energy intake of rats receiving a normal-protein diet (P14) and thereafter a high-protein diet (P50) for 14 d. Results presented are ± SEM. Adapted from Reference with permission.

Figure 2

Vagal signaling by proteins and amino acids induces neuronal activation in the nucleus tractus solitarius (NTS). Photomicrograph of the rostral part of the NTS. Double-labeled Fos/GLP-1 neurons (brown nuclei and blue/gray cytoplasm, magnification ×20). Zoom (magnification ×40) shows 1 double-labeled neuron. 5-HT, serotonin; AP, area postrema; CCK, cholecystokinin; GLP-1, glucagon-like particle 1; PYY, peptide YY. Adapted from Reference with permission.

Figure 3

A high-protein load (55% protein as energy) compared with a normal protein (NP) load (14% protein as energy) leads to decreased messenger RNA expression of orexin-1 receptor in nodose ganglia (A) and decreased activity of orexin neurons in the lateral hypothalamus (B). A, Effect of a high-protein (HP) diet on messenger RNA expression of orexin-1 receptor (OX1-R) in nodose ganglia. Male mice were adapted for 15 d to their respective diets: NP or HP diet (n = 6). Mice were fasted overnight and killed 2 h after receiving an intragastric load of their respective diets (4.07 kcal). To measure orexin-1 receptor expression, 4 nodose ganglia were pooled in each observation. Primers used in this experiment (5′-3′) are OX1-R sense (ACGGCGAGCTGTGCTCTT), OX1-R antisense (CCTGGACCGCTGGTATGC), 18S-sense (ACGGAAGGGCACCACCAGGAG), and 18S antisense (GACCCACCACCCACGGAAACG). Results represent relative expression compared with 18S (2^−ΔCT; CT = CT_ORX1-R − CT_18S) ± SEM. *Significant effect of diet (P ≤ 0.05). Adapted from Reference with permission. B, Effect of an intragastric load of protein on the activity of orexin neurons in the LH in rats. Male rats (n = 18) adapted to an NP diet were separated into 2 groups (n = 9), fasted overnight, and killed 90 min after receiving an intragastric load (10.5 kcal) of an NP or HP diet. Rats were perfused intracardially with saline and 4% paraformaldehyde in PBS, and brains were then cryoprotected in 30% sucrose. Transverse 20-μm thick lateral hypothalamus sections were cut with a cryostat (Bregma −3,70; −1,30). Briefly, sections were mounted on slides, dried overnight, and frozen (−20°C). For immunochemistry, slides were rinsed in PBS, incubated in 2% bovine serum albumin for 60 min, incubated for 24 h with rabbit anti–c-Fos antibody (1:1000) (Calbiochem) at room temperature. Sections were then placed for 3 h at room temperature with a biotyinlated goat anti-rabbit secondary antibody (1:200) diluted in PBS-bovine serum albumin, and revealed with diaminobenzidine (Sigma). c-Fos staining was followed by neuronal phenotype staining [primary antibody rabbit anti-orexin (Oncogene), 1/100; anti-rabbit secondary antibody, 1:200 (Vector)]. Orexin neurons were revealed by reaction with an Elite Vectastain SG kit (Vector). After washing and drying overnight, sections were cleared in ethanol and xylene. Results are presented as means ± SEM per section. *Significant effect of the load P ≤ 0.01. Adapted from Reference with permission.

Figure 4

Proteins up-regulate pro-opiomelanocortin (POMC) and down-regulate neuropeptide Y (NPY) and agouti-related protein (AgRP) in the rat hypothalamus, via a phosphorylated mammalian target of rapamycin (mTOR) and phosphorylated AMP-activated protein kinase (AMPK)–dependent mechanism.

Figure 5

Mechanisms responsible for the protein-induced reduction in food intake. Protein intake leads to the production of specifics hormones that reach the brain via the vagus nerve or bloodstream. Centrally, hormonal signaling reaches different regions of the brain: the nucleus tractus solitarius and the arcuate nucleus (ARC) would be responsible for increased satiety, and protein ingestion would decrease the motivation to eat in the mesolimbic reward system (including the nucleus accumbens). The role of decision-making areas is not yet well understood. CCK, cholecystokinin; GLP-1, glucagon-like peptide 1; PYY, peptide YY.