Homeodomain POU and Abd-A proteins regulate the transcription of pupal genes during metamorphosis of the silkworm, Bombyx mori

Abstract

A cascade of 20-hydroxyecdysone-mediated gene expression and repression initiates larva-to-pupa metamorphosis. We recently showed that two transcription factors, BmPOUM2 and BmβFTZ-F1, bind to the cis-regulatory elements in the promoter of the gene coding for cuticle protein, BmWCP4, and regulate its expression during Bombyx mori metamorphosis. Here we show that down-regulation of BmPOUM2 expression by RNA interference during the wandering stage resulted in failure to complete metamorphosis. The thorax epidermis of RNA interference-treated larvae became transparent, wing disc growth and differentiation were arrested, and the larvae failed to spin cocoons. Quantitative real-time PCR analysis showed that expression of the genes coding for pupal-specific wing cuticle proteins BmWCP1, BmWCP2, BmWCP3, BmWCP4, BmWCP5, BmWCP6, BmWCP8, and BmWCP9 were down-regulated in BmPOUM2 dsRNA-treated animals, whereas overexpression of BmPOUM2 protein increased the expression of BmWCP4, BmWCP5, BmWCP6, BmWCP7, and BmWCP8. Pull-down assays, far-Western blot, and electrophoretic mobility shift assay showed that the BmPOUM2 protein interacted with another homeodomain transcription factor, BmAbd-A, to induce the expression of BmWCP4. Immunohistochemical localization of BmPOUM2, BmAbd-A, and BmWCP4 proteins revealed that BmAbd-A and BmPOUM2 proteins are colocalized in the wing disc cell nuclei, whereas BmWCP4 protein is localized in the cytoplasm. Together these data suggest that BmPOUM2 interacts with the homeodomain transcription factor BmAbd-A and regulates the expression of BmWCP4 and probably other BmWCPs to complete the larva-to-pupa transformation. Although homeodomain proteins are known to regulate embryonic development, this study showed that these proteins also regulate metamorphosis.

Fig. 1.

Effects of RNAi-mediated silencing of the gene coding for BmPOUM2 on the metamorphosis of B. mori. A total of 10 μg of dsRNA per larva was injected into the intersegmental region between the second and third thoracic segments of fifth-instar larvae at day 0 of the wandering stage. Total RNA and proteins were extracted from the epidermis of the wing discs of the dsRNA-injected larvae. (A) qRT-PCR analysis of BmPOUM2 mRNA was performed with wild-type and dsRNA-treated larvae, and β-actin amplified from the same RNA samples was used as the internal control. *P < 0.05 (BmPOUM2 dsRNA treatment vs. GFP dsRNA control; t test). (B) Western blot analysis of BmPOUM2 and BmWCP4 proteins in wild-type and dsRNA-treated larvae. Protein (50 μg) was loaded per lane and probed with anti-BmPOUM2 and -BmWCP4 antibodies, respectively. WT, wild type; GFP, EGFP dsRNA; POUM2, BmPOUM2 dsRNA. (C) Phenotypes of dsRNA-treated larvae. (D) Developmental stage of the wing discs in EGFP dsRNA-treated (Upper) and BmPOUM2 dsRNA-treated (Lower) larvae at different times after dsRNA treatment. (E) Development of the silk gland of the RNAi-treated larvae at 24 and 72 h after the treatment. (F) Larval and pupal phenotypes at 24 h (A and B), 48 h (C), and 72 h (D) after EGFP dsRNA and BmPOUM2 dsRNA treatments. hpt, hours postinjection.

Fig. 2.

qRT-PCR analysis of BmWCPs DDC, and sericin-1 in the wing disc epidermis of the dsRNA-treated larvae. In the qRT-PCR analysis, both quantitative and relative expression levels of BmWCP1-6 (A–F), BmWCP8–11 (G–J), DDC (K), and sericin-1 (L) were calculated after normalizing with β-actin expression as an internal control using the same RNA samples. Each data point represents mean ± SE (n = 3).

Fig. 3.

Interaction analysis of BmPOUM2 with BmAbd-A. (A) His-tag pull-down assay of BmPOUM2 and other proteins. Proteins were extracted from the wing discs of fifth-instar larvae at the prepupal stage. Lane 1 shows that BmPOUM2 protein incubated with PBS as control. Lane 2 shows that BmPOUM2 protein incubated with the protein extracted from wing disc tissues. The arrowhead indicates the pull-down protein of ∼43 kDa (lane 2) that binds with BmPOUM2, and arrows indicate the BmPOUM2 protein. (B) Far-Western blot analysis of BmPOUM2 and BmAbd-A protein. The protein extracts from the wing discs (50 μg) (a) and the His-tag affinity-purified recombinant BmAbd-A protein (1 μg) (b) were separated by using 12% (wt/vol) SDS/PAGE and transferred to nitrocellulose membranes. The membranes were either used for direct immunoblots using anti-BmPOUM2 antibody (−) or used for far-Western blot analysis, where the recombinant BmPOUM2 protein was incubated with the membrane before adding the anti-BmPOUM2 antibody (+). Positive bands were observed only when BmPOUM2 or BmPOUM2/BmAbd-A complex was present. (C) Pull-down assay with His–BmAbd-A. Purified recombinant His–BmAbd-A protein was incubated with the protein extracts from the wing discs, and then the His–BmAbd-A bound protein was purified with Ni-NTA beads. The purified His–BmAbd-A–bound protein was eluted and separated on SDS/PAGE (lanes 2 and 5). The purified His–BmAbd-A protein that was incubated with PBS buffer was used as a negative control (lanes 1 and 4). Another negative control, Ni-NTA beads alone incubated with the proteins, was used to exclude the possibility of any nuclear proteins directly interacting with the NTA resin (lanes 3 and 6). The protein was transferred to the membrane and probed with anti-BmPOUM2 antibody (lanes 4–6).

Fig. 4.

EMSA for binding of BmPOUM2 and BmPOUM2/BmAbd-A complex to the POU-CRE of the BmWCP4 promoter. (A) EMSA for the detection of the interaction between BmPOUM2 and BmAbd-A and the ensuing complex binding to the POU CRE of the BmWCP4 promoter. (B) Mutation analysis of the BmPOUM2 binding to the POU CRE of BmWCP4 gene. Wild-type sequence of the POU CRC is CAATAACCTTTACATTAGATGCCTTC (the conserved core octamer motif is underlined). Mutant 1, the first three bases of the motif were changed to TGCTGCAT (lanes 3 and 7); mutant 2, the first five bases were changed to TGCCCCAT (lanes 4 and 8); mutant 3, all of the bases of the motif were changed to CAGATTGC (lanes 5 and 9).

Fig. 5.

Schematic representation of the model of molecular regulation of the expression of BmWCP4 as well as other BmWCP genes by nuclear transcription factors in response to 20E and JH during metamorphosis in B. mori. 20E binds to the heterodimer of the USP/ecdysone receptor, which either directly or indirectly activates the expression of the transcription factors BmPOUM2 and BmβFTZ-F1. While BmβFTZ-F1 binds to the corresponding BmβFTZ-F1 CRE, the nuclear homeodomain transcription factor BmPOUM2 interacts with another homeodomain transcription factor, BmAbd-A, to form a complex, which binds to the corresponding POU CRE in the BmWCP4 regulatory region to activate the expression of BmWCP4, as well as other genes coding for pupal wing disc cuticle proteins (pathway 1). BmPOUM2 may also indirectly activate expression of the genes coding for other BmWCP proteins by activating other unidentified transcription factor(s) that interact with CREs in the promoter of these genes (pathway 2). Activation of other BmWCP genes may not act through the direct (pathway 1) or indirect (pathway 2) action of BmPOUM2 but through unknown transcription factor(s) in the regulation of the expression of BmWCP genes (pathway 3). All these pathways work together, leading to the postlarval development and differentiation of the wing disc during metamorphosis.