Establishment of phosphatidylinositol 3-kinase inhibitor-resistant cancer cell lines and therapeutic strategies for overcoming the resistance

Abstract

Acquired resistance is a major obstacle for conventional cancer chemotherapy, and also for some of the targeted therapies approved to date. Long-term treatment using protein tyrosine kinase inhibitors (TKIs), such as gefitinib and imatinib, gives rise to resistant cancer cells carrying a drug-resistant gatekeeper mutation in the kinase domain of the respective target genes, EGFR and BCR-ABL. As for the phosphatidylinositol 3-kinase inhibitors (PI3Kis), little is known about their acquired resistance, although some are undergoing clinical trials. To address this issue, we exposed 11 human cancer cell lines to ZSTK474, a PI3Ki we developed previously, for a period of more than 1 year in vitro. Consequently, we established ZSTK474-resistant cells from four of the 11 cancer cell lines tested. The acquired resistance was not only to ZSTK474 but also to other PI3Kis. None of the PI3Ki-resistant cells, however, contained any mutation in the kinase domain of the PIK3CA gene. Instead, we found that insulin-like growth factor 1 receptor (IGF1R) was overexpressed in all four resistant cells. Interestingly, targeted knockdown of IGF1R expression using specific siRNAs or inhibition of IGF1R using IGF1R-TKIs reversed the acquired PI3Ki resistance. These results suggest that long-term treatment with PI3Kis may cause acquired resistance, and targeting IGF1R is a promising strategy to overcome the resistance.

Figure 1

Sensitivities to ZSTK474 in ZSTK474‐resistant cell lines and their parental cell lines. Acquisition of resistance following long‐term exposure to ZSTK474. SF295 (26 months), OVCAR3, SNB75, and SNB78 (12 months) were exposed to ZSTK474 for the period indicated in parentheses. Sensitivities to ZSTK474 in drug‐treated cells and their parental cells were then examined. Assays were carried out in triplicate and the data are the average of three independent experiments. Error bars = SD.

Figure 2

Changes in sensitivity to ZSTK474 after exposure to or removal of ZSTK474. (A) SF295 cells were treated with ZSTK474 (10 μM) for the indicated period. The GI ₅₀ values of drug‐treated and untreated control cells were calculated by using dose response curves of ZSTK474 as described in Materials and Methods. Relative ZSTK474 resistance was then calculated as GI _{50 sample}/GI _{50 control}. Drug‐treated cells were a mixture of cells proliferating in the presence of ZSTK474. Assays were carried out in quadruplicate. (B) Loss of ZSTK474 resistance after drug withdrawal. SF295‐R cells were cultured in the absence of ZSTK474 for the indicated period. Drug resistance was gradually weakened and finally cells restored sensitivity to ZSTK474 to a level comparable to that of the parental SF295 cells. The resistant cells after drug withdrawal for each period were a mixture of cells grown in the absence of ZSTK474. Sample designations SF295‐R/df3, SF295‐R/df14, and SF295‐R/df100 represent SF295‐R cells incubated in the absence of ZSTK474 for 3, 14, and >100 days, respectively. Assays were carried out in triplicate and the present data are representative of two independent experiments.

Figure 3

Overexpression of insulin‐like growth factor 1 receptor (IGF1R) in ZSTK474‐resistant cells. (A,B) Expression levels of IGF1R in SF295, SF295‐R, SF295‐R/df3, SF295‐R/df14, and SF295‐R/df100 cells. IGF1R mRNA levels were quantified by real‐time quantitative PCR (A) and IGF1R protein levels were analyzed by immunoblot assay (B). Expression levels of IGF1R correlated well with resistance levels to ZSTK474. The present data are representative of two independent experiments. (C) Immunoblot analysis of IGF1R expression in three parental and their respective ZSTK474‐resistant cells. Expression of β‐actin was also determined to ensure equal loading of protein in each lane (control). The data are representative of two independent experiments.

Figure 4

Effect of insulin‐like growth factor 1 receptor (IGF1R) siRNAs on protein expression levels of IGF1R and sensitivity to ZSTK474 in SF295 and SF295‐R cells. (A) Expression levels of IGF1R protein were analyzed by immunoblot assay in SF295‐R and parental SF295 cells transfected with control siRNA (si‐cont) or IGF1R‐siRNA (siIGF1R‐1, 5′‐UUAAUGAGCAAAUUGCCCUUGAAGA‐3′; siIGF1R‐2, 5′‐UAAACGGUGAAGCUGAUGAGAUCCC‐3′) and incubated for 48 h. Protein levels were dramatically reduced in SF295‐R cells after 48 h incubation following transfection with IGF1R‐siRNA. (B) Effects of IGF1R siRNAs on ZSTK474 sensitivity of SF295‐R and parental SF295 cells. After transfection with siRNA, cells were incubated overnight, replated on 96‐well plates, allowed to attach overnight, then treated with the indicated concentration of ZSTK474 for 48 h. Cell growth was assessed by sulforhodamine B assay and the relative growth of the ZSTK474 treated cells compared to that of the untreated cells was calculated. SF295‐R cells transfected with IGF1R‐siRNA showed restored sensitivity to ZSTK474 comparable to that of the parental SF295 cells. Assays were carried out in duplicate and the data are representative of two independent experiments.

Figure 5

Effects of OSI‐906 and ZSTK474 in combination on the growth of SF295‐R and parental SF295 cells. (A) Dose–response curves of ZSTK474 in the presence or absence of OSI‐906. SF295‐R and parental SF295 cells were cotreated with the indicated doses of ZSTK474 and OSI‐906 for 48 h. Relative growth at each dose of OSI‐906 in the absence of ZSTK474 was normalized as 100%. (B) Evaluation of the effects of ZSTK474 and OSI‐906 combination by isobologram analysis of the same data as in (A). This drug combination showed a superadditive (synergistic) effect on SF295‐R cells but only an additive effect on parental SF295 cells. Assays were carried out in duplicate.

Figure 6

Activation status of the phosphatidylinositol 3‐kinase–Akt pathway in SF295, SF295‐R, and SF295‐R/df100 cells after exposure to ZSTK474. The cells were treated with the indicated concentrations of ZSTK474 for 3 h. Cells were harvested and immunoblot analysis of insulin‐like growth factor 1 receptor (IGF1R‐β), phosphorylated IGF1R (p‐IGF1R‐β), phosphorylated Akt (p‐Akt) at Thr308 and Ser473, and phosphorylated ERK1/2 (p‐ERK1/2) were carried out.

Figure 7

Effect of insulin‐like growth factor 1 receptor (IGF1R) siRNA on expression levels of phosho‐Akt in SF295‐R cells after exposure to ZSTK474. SF295 and SF295‐R cells were transfected with control siRNA (sicont) or IGF1R siRNA (siIGF1R‐1). Cells were then exposed to ZSTK474 at the indicated concentrations for 3 h. Cells were harvested and immunoblot analysis of IGF1R and phosphorylated Akt at Thr308 and Ser473 were carried out.