Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
Comparative Study
. 1990 Jan 5;211(1):19-33.
doi: 10.1016/0022-2836(90)90008-A.

Intramolecular DNA triplexes, bent DNA and DNA unwinding elements in the initiation region of an amplified dihydrofolate reductase replicon

Affiliations
Comparative Study

Intramolecular DNA triplexes, bent DNA and DNA unwinding elements in the initiation region of an amplified dihydrofolate reductase replicon

M S Caddle et al. J Mol Biol. .

Erratum in

  • J Mol Biol 1990 Apr 20;212(4):865

Abstract

The nucleotide sequence of 6.2 kb (1 kb = 10(3) base-pairs) of DNA that encompasses the earliest replicating portion of the amplified dihydrofolate reductase domains of CHOC 400 cells has been determined. Origin region DNA contains two AluI family repeats, a novel repetitive element (termed ORR-1), a TGGGT-rich region, and several homopurine/homopyrimidine and alternating purine/pyrimidine tracts, including an unusual cluster of simple repeating sequences composed of (G-C)5, (A-C)18, (A-G)21, (G)9, (CAGA)4, GAGGGAGAGAGGCAGAGAGGG, (A-G)27. Recombinant plasmids containing origin region sequences were examined for DNA structural conformations previously implicated in origin activation. Mung bean nuclease sensitivity assays for DNA unwinding elements show the preferred order of nuclease cleavage at neutral pH in supercoiled origin plasmids to be: (A-T)23 much greater than the (A-G) cluster much greater than (A)38 much greater than vector = (AATT)n. At acid pH, the hierarchy of cleavage preferences changes to: the (A-G) cluster much greater than (A-T)23 much greater than (AATT)n greater than vector = (A)38. A region of stably bent DNA was identified and shown not to be reactive in the mung bean nuclease unwinding assay at either acid or neutral pH. Intermolecular hybridization studies show that, in the presence of torsional stress at pH 5.2, the (A-G) cluster forms triple-stranded DNA. These results show that the origin region of an amplified chromosomal replicon contains a novel repetitive element and multiple sequence elements that facilitate DNA bending, DNA unwinding and the formation of intramolecular triple-stranded DNA.

PubMed Disclaimer

Publication types

Associated data

LinkOut - more resources