Individual RNA base recognition in immobilized oligonucleotides using a protein nanopore

Abstract

Protein nanopores are under investigation as key components of rapid, low-cost platforms to sequence DNA molecules. Previously, it has been shown that the α-hemolysin (αHL) nanopore contains three recognition sites, capable of discriminating between individual DNA bases when oligonucleotides are immobilized within the nanopore. However, the direct sequencing of RNA is also of critical importance. Here, we achieve sharply defined current distributions that enable clear discrimination of the four nucleobases, guanine, cytosine, adenine, and uracil, in RNA. Further, the modified bases, inosine, N(6)-methyladenosine, and N(5)-methylcytosine, can be distinguished.

Figure 1. Interaction of homopolymeric RNA strands with αHL pores

(a) Schematic representation of a homopolymeric RNA oligonucleotide (green circles), with a single ribonucleotide substituted at position 9 (red circle), immobilized inside an αHL pore (grey, cross-section) by using a 3'-biotin-TEG (purple)•streptavidin (blue) complex. The structure of the biotin linker is provided in Figure S1. The αHL pore can be divided into 2 parts, each 5 nm in length; an upper vestibule located between the cis entrance and the central constriction, and a 14-stranded, transmembrane, antiparallel β barrel, located between the central constriction and trans entrance. The oligonucleotide bases are numbered relative to the 3'-biotin tag and position 9 was chosen for interrogation by recognition site R₁ (at the constriction). (b) The amino acid sequence of the transmembrane β barrel. The mutated residues at the top of the barrel are highlighted (red); these mutations enlarge the diameter of the pore. (Right, top) A view of the WT residues Glu-111, Lys-147 and Met-113 from the cis side of the pore. These residues form a constriction with diameter of ~13 Å. (Right, bottom) A view of the NNY residues Asn-111, Asn-147 and Tyr-113 from the cis side of the pore. These residues form a constriction with diameter of ~18 Å. The images were generated in Pymol. (c) Histogram of the residual current levels for RNA homopolymers oligo(rA)₃₀, oligo(rC)₃₀ and oligo(rU)₃₀ immobilized in the WT αHL pore. (d) Histogram of the residual current levels for the homoheptameric αHL pore formed from the mutant E111N/K147N (NN). (e) Histogram of the residual current levels for the homoheptameric αHL pore formed from the mutant E111N/K147N/M113Y (NNY). Gaussian fits were performed for each peak, and the mean value of the open pore (I_O), the residual currents (I_RES%) and the standard deviation for each oligonucleotide are displayed in the table below the histograms.

Figure 2. Discrimination of individual ribobases in ssDNA and ssRNA with the WT, NN and NNY αHL pores

(a) Current traces for immobilized ssDNAs and (b) ssRNAs in the αHL NNY pore at +200 mV. (Below) Sequences of the oligonucleotides, biotinylated at the 3' ends. Two sets of four oligonucleotides were used, based on oligo(dC)₃₀ and oligo(rA)₃₀. Each set contained rG, rA, rC, or rU at position 9 (represented by X) relative to the biotin tag. Residual current (I_RES%) histograms were compiled for oligonucleotide sets examined with the three αHL pores: (c) oligo(dC)₃₀ oligonucleotides examined with the WT pore. (d) oligo(dC)₃₀ oligonucleotides examined with the NN pore. (e) oligo(dC)₃₀ oligonucleotides examined with the NNY pore. (f) oligo(rA)₃₀ oligonucleotides examined with the WT pore. (g) oligo(rA)₃₀ oligonucleotides examined with the NN pore. (h) oligo(rA)₃₀ oligonucleotides examined with the NNY pore. Experiments were conducted at least 3 times, and the results displayed in each histogram are from a typical experiment. Gaussian fits were performed for each peak, and the mean values of the open pore currents (I_O, pA), the normalized residual currents (I_RES%) and the differences in the normalized residual currents (ΔI_RES%) are displayed in the tables below the histograms with their standard deviations (± S.D). ΔI_RES% is defined as the difference in residual current between an rX (X= rG, rC, rA or rU) oligonucleotide and either oligo(dC)₃₀ or oligo(rA)₃₀. ΔI_RES%^rX-oligo(dC) = I_RES for the rX oligonucleotide - I_RES for oligo(dC)₃₀ or ΔI_RES%^rX-oligo(rA) = I_RES% for the rX oligonucleotide - I_RES% for oligo(rA)₃₀.

Figure 3. Discrimination of individual modified ribobases in ssDNA and ssRNA with the NNY αHL pore

(a) Chemical structures of the modified bases: rI, inosine; m⁶A, N⁶-methyladenosine; m⁵C, 5-methylcytosine. (Below) Sequences of oligonucleotides biotinylated at the 3' end. Three sets of five oligo(dC)₃₀ or five oligo(rA)₃₀ oligonucleotides were used. Each set contained oligonucleotides with the four standard bases, rG, rA, rC, or rU at position 9 (represented by X) relative to the biotin tag, as well as an oligonucleotide with a modified base, one of rI, m⁶A or m⁵C. Histograms of the residual currents (I_RES%) from oligonucleotide sets examined with the NNY pore were constructed: (b) the oligo(dC)₃₀ set containing rI; (c) the oligo(rA)₃₀ set containing rI; (d) the oligo(rA)₃₀ set containing m⁶A; (e) the oligo(rA)₃₀ set containing m⁵C oligo(rA)₃₀. Experiments were conducted at least 3 times, and the results displayed in each panel are from a typical experiment. Gaussian fits were performed for each peak, and the mean values of the open pore currents (I_O, pA), the normalized residual currents (I_RES%) and the differences between the normalized residual currents (ΔI_RES%) are displayed in the table below the histograms with their standard deviations (± S.D). ΔI_RES% is defined as the residual current between an rX (X= rG, rC, rA, rU, rI, m⁶A or m⁵C) oligonucleotide and either oligo(dC)₃₀ or oligo(rA)₃₀. ΔI_RES%^rX-oligo(dC) = I_RES% of the rX oligonucleotide - I_RES% of oligo(dC)₃₀ and ΔI_RES%^rX-oligo(rA) = I_RES% of the rX oligonucleotide - I_RES% of oligo(rA)₃₀. The experiments were conducted at +200 mV.

Figure 4. Plots of residual current difference for all seven bases identified in ssDNA and ssRNA oligonucleotides

(a) ΔI_RES% for each base substituted at position 9 of oligo(dC)₃₀ for WT (black bars), NN (green bars) and NNY (blue bars) αHL pores. ΔI_RES%^rX-oligo(dC) = I_RES% of the rX oligonucleotide - I_RES% of oligo(dC)₃₀. X = rG, rA, rC, rU, rI, m⁶A or m⁵C. (b) ΔI_RES% for each base substituted at position 9 of oligo(rA)₃₀ for WT (black bars), NN (green bars) and NNY (blue bars) αHL pores. ΔI_RES%^rX-oligo(rA) = I_RES% of the rX oligonucleotide - I_RES% of oligo(rA)₃₀. X = rG, rA, rC, rU, rI, m⁶A or m⁵C. The errors given are standard deviations from three experiments (Table S5 and S6).

Figure 5. Discrimination of individual ribobases in heteropolymeric ssRNA with the NNY αHL pore

(a) Histogram of the residual currents (I_RES%) from a heteropolymeric ssRNA set (sequence 5’-[r]UAGCUAAACCGAUAGCUUCAGXCAUGUAAC[Btn]-3’) examined with the NNY pore. The four 3'-biotinylated RNA strands differed only at position 9 as shown. Experiments were conducted at least 3 times, and the panel displays the results from a typical experiment. Gaussian fits were performed for each peak, and the mean values of the open pore currents (I_O, pA) and the normalized residual currents (I_RES%) are displayed in the table below the histogram. (b) Plots of I_RES% versus the applied potential for the bases at position 9: rG, rA, rC and rU. (c) Plots of residual current difference, ΔI_RES%, for each base. ΔI_RES% ^rX-rA = I_RES% of the rX-het₃₀ oligonucleotide - I_RES% of rA-het₃₀ oligonucleotide. The errors given are standard deviations from three independent experiments (Table S7).