In vitro site selection of a consensus binding site for the Drosophila melanogaster Tbx20 homolog midline

Abstract

We employed in vitro site selection to identify a consensus binding sequence for the Drosophila melanogaster Tbx20 T-box transcription factor homolog Midline. We purified a bacterially expressed T-box DNA binding domain of Midline, and used it in four rounds of precipitation and polymerase-chain-reaction based amplification. We cloned and sequenced 54 random oligonucleotides selected by Midline. Electromobility shift-assays confirmed that 27 of these could bind the Midline T-box. Sequence alignment of these 27 clones suggests that Midline binds as a monomer to a consensus sequence that contains an AGGTGT core. Thus, the Midline consensus binding site we define in this study is similar to that defined for vertebrate Tbx20, but differs from a previously reported Midline binding sequence derived through site selection.

Figure 1. Comparison of previously identified motifs of midline and Tbx20.

A) A schematic of D. melanogaster Midline protein based on clone RE27439 drawn using Prosite MyDomains . The fragment used in our analysis – green line (amino acids 171–393) spans the DNA binding T-box domain – blue box (amino acids 187–383). The EH1domain in the N-terminal region is in orange. B) The DNA binding motif of mouse Tbx20 is derived from the site selection data presented by Macindoe et al. , while the mid DNA binding motif was generated from data by Liu et al. . Comparison of the aligned motifs show that the two homologues only have positions 0–3 in common. Nucleotides at all other positions differ, suggesting that Drosophila Mid recognizes a different consensus sequence than that bound by other Tbx20 proteins. C) The binding consensus identified by Liu et al. (GGAAGTAGGTCAAG ) , full Brachyury palindrome (T-palindrome AATTTCACACCTAGGTGTGAAATT) and the Tbx20 consensus derived by MacIndoe et al. (GGAGGTGTGAGGCGA) were tested on an EMSA for interaction with the T-box domain of bacterially expressed Mid.

Figure 2. Site selection workflow and EMSAs on cloned fragments.

A) Outline of the selection procedure carried out to determine the DNA binding motif of Mid. In the first round, oligonucleotides consisting of a random 26 nucleotide core flanked by primer sequences were incubated with mid_Tbx. After purification and PCR amplification of co-precipitated fragments, the PCR amplified fragments were used in subsequent rounds of selection. B) All 54 oligonucleotide fragments were cloned and used as a template to create probes for EMSAs. Each probe was tested for recognition by Mid_Tbx. Probes positive for shifts, such as 2, 4, 57, 67 and 57 were tested a minimum of two times. Probes negative for shifts, such as 5, 10, 22, 48, and 64 were tested 3–5 times to exclude the possibility of false negatives. Arrows point to streaks often seen in probes that were weakly bound. Probes that did not display a noticeable, shifted band were considered to be unrecognized.

Figure 3. DNA motif selected by Mid_Tbx.

A) The sequence logo corresponding to the oligonucleotide selected by Mid_Tbx after 4 rounds of selection. The 27 EMSA verified sequences and the flanking primer sequences for some were input into MEME. MEME was set to use each nucleotide once and to generate a motif with a maximum length of 26 nucleotides. Region 1 and 2 are underlined in black and blue respectively. B) Aligned sequences of the 27 oligonucleotides used to generate the motif in A. The 15 nucleotides present in A are colour coded according to the nucleotide. Flanking sequences are in black. Nucleotides within the random 26 bp core are in uppercase, while those found within the primer sequences are in lowercase. The second potential Mid_Tbx binding site in oligonucleotides represented by clones 2, 8, 42, 74, and 75, has been underlined. C) An EMSA using the 15 base pair consensus motif identified in this study. The migration of oligonucleotides with wild-type Mid binding motif (CAAGGTGTCAAGGCG) is slowed in the presence of Mid_Tbx. However, Mid_Tbx does not appear to have an affinity for oligonucleotides where region 1 has been mutated (CACCCCCCCAAGGCG). Oligonucleotides mutant for region 2 (CAAGGTGTCAAGGAA) are still bound and retarded by Mid_Tbx.

Figure 4. Protein sequence alignment of the T-box domain of select T-box genes.

The T-box domain of Mid is aligned with its vertebrate homologue Tbx20 as well as T-box genes for which the crystal structure has been solved (obtained from Pfam and modified to remove gaps [43]). Amino acid residues conserved in all 5 members are in dark blue, while those found in 4 out of 5 are in a lighter shade of blue. Residues implicated in direct interactions with the DNA based on the crystal structures of Tbx3, Tbx5 and Xbra are highlighted in black , , . Those that are involved in dimerization or monomer-monomer contacts in the Xbra cystals are highlighted in brown , . Amino acids involved in the small monomer interface of Tbx3 are highlighted in red.