Multiple sodium channel variants in the mosquito Culex quinquefasciatus

Abstract

Voltage-gated sodium channels are the target sites of both DDT and pyrethroid insecticides. The importance of alternative splicing as a key mechanism governing the structural and functional diversity of sodium channels and the resulting development of insecticide and acaricide resistance is widely recognized, as shown by the extensive research on characterizing alternative splicing and variants of sodium channels in medically and agriculturally important insect species. Here we present the first comparative study of multiple variants of the sodium channel transcripts in the mosquito Culex quinquefasciatus. The variants were classified into two categories, CxNa-L and CxNa-S based on their distinguishing sequence sizes of ~6.5 kb and ~4.0 kb, respectively, and generated via major extensive alternative splicing with minor small deletions/ insertions in susceptible S-Lab, low resistant HAmCq(G0), and highly resistant HAmCq(G8)Culex strains. Four alternative Cx-Na-L splice variants were identified, including three full length variants with three optional exons (2, 5, and 21i) and one with in-frame-stop codons. Large, multi-exon-alternative splices were identified in the CxNa-S category. All CxNa-S splicing variants in the S-Lab and HAmCq(G0) strains contained in-frame stop codons, suggesting that any resulting proteins would be truncated. The ~1000 to ~3000-fold lower expression of these splice variants with stop codons compared with the CxNa-L splicing variants may support the lower importance of these variants in S-Lab and HAmCq(G0). Interestingly, two alternative splicing variants of CxNa-S in HAmCq(G8) included entire ORFs but lacked exons 5 to18 and these two variants had much higher expression levels in HAmCq(G8) than in S-Lab and HAmCq(G0). These results provide a functional basis for further characterizing how alternative splicing of a voltage-gated sodium channel contributes to diversity in neuronal signaling in mosquitoes in response to pyrethroids, and possibly indicates the role of these variants in the development of pyrethroid resistance.

Keywords: Culex quinquefasciatus.; Sodium channel; alternative splicing; insecticide resistance; transcript variants.

Figure 1

Polymerase chain reaction (PCR) amplification of para-type sodium channel transcripts from genomic RNAs of Culex mosquitoes. Sodium channel cDNA transcripts amplified from RNAs isolated from S-Lab, HAmCq^G0 and HAmCq^G8 mosquito strains were subjected to PCR amplification using a primer pair: KDR S16 (TGTTGGCCATATAGACAATGACCGA)/KDR AS09 (GCTTCTGAATCTGAATCAGAGGGAG), synthesized based on the respective 5' and 3' end sequences of the putative sodium channel genes .

Figure 2

Alignment of deduced amino acid transcript sequences of the para-type sodium channel transcripts (Cx-Na) in S-Lab Culex mosquitoes. Transmembrane segments are indicated on the line over the sequence. Exons are indicated above the sequence with solid triangle symbols to indicate the boundaries between exons. The differences in the aa sequences are indicated by shading. A stop codon is marked by an asterisk (*). - indicates deletions. ∆ indicates insertions with the sequences of ∆1: P; ∆2: VSEITRTTAPTATAAGTAKARKVSA; ∆3: GAIIVPVYYANL; ∆4:*I; ∆5: VSVYYFPT; ∆6: GPFR; ∆7: E; ∆8:*; ∆9: **SSR**VR; ∆10: *HCQY; ∆11:*; ∆12: G; ∆13: R; ∆14: R; ∆15: RRR; ∆16: T; ∆17: R; ∆18: A; ∆19: G; ∆20:**

Figure 2

Alignment of deduced amino acid transcript sequences of the para-type sodium channel transcripts (Cx-Na) in S-Lab Culex mosquitoes. Transmembrane segments are indicated on the line over the sequence. Exons are indicated above the sequence with solid triangle symbols to indicate the boundaries between exons. The differences in the aa sequences are indicated by shading. A stop codon is marked by an asterisk (*). - indicates deletions. ∆ indicates insertions with the sequences of ∆1: P; ∆2: VSEITRTTAPTATAAGTAKARKVSA; ∆3: GAIIVPVYYANL; ∆4:*I; ∆5: VSVYYFPT; ∆6: GPFR; ∆7: E; ∆8:*; ∆9: **SSR**VR; ∆10: *HCQY; ∆11:*; ∆12: G; ∆13: R; ∆14: R; ∆15: RRR; ∆16: T; ∆17: R; ∆18: A; ∆19: G; ∆20:**

Figure 2

Alignment of deduced amino acid transcript sequences of the para-type sodium channel transcripts (Cx-Na) in S-Lab Culex mosquitoes. Transmembrane segments are indicated on the line over the sequence. Exons are indicated above the sequence with solid triangle symbols to indicate the boundaries between exons. The differences in the aa sequences are indicated by shading. A stop codon is marked by an asterisk (*). - indicates deletions. ∆ indicates insertions with the sequences of ∆1: P; ∆2: VSEITRTTAPTATAAGTAKARKVSA; ∆3: GAIIVPVYYANL; ∆4:*I; ∆5: VSVYYFPT; ∆6: GPFR; ∆7: E; ∆8:*; ∆9: **SSR**VR; ∆10: *HCQY; ∆11:*; ∆12: G; ∆13: R; ∆14: R; ∆15: RRR; ∆16: T; ∆17: R; ∆18: A; ∆19: G; ∆20:**

Figure 3

Alignment of deduced amino acid transcript sequences of the para-type sodium channel reanscripts (Cx-Na) in HAmCq^G0 Culex mosquitoes. Transmembrane segments are indicated on the line over the sequence. Exons are indicated above the sequence with solid triangle symbols to indicate the bounderies between exons. The differences in the aa sequences are indicated by shading. A stop codon is marked by an asterisk (*). - indicates deletions. ∆ indicates insertions with the sequences of ∆1: VSEITRTTAPTATAAGTAKARKVSA; ∆2: AA; ∆3: R; ∆4: *F; ∆5: L; ∆6: G.

Figure 3

Alignment of deduced amino acid transcript sequences of the para-type sodium channel reanscripts (Cx-Na) in HAmCq^G0 Culex mosquitoes. Transmembrane segments are indicated on the line over the sequence. Exons are indicated above the sequence with solid triangle symbols to indicate the bounderies between exons. The differences in the aa sequences are indicated by shading. A stop codon is marked by an asterisk (*). - indicates deletions. ∆ indicates insertions with the sequences of ∆1: VSEITRTTAPTATAAGTAKARKVSA; ∆2: AA; ∆3: R; ∆4: *F; ∆5: L; ∆6: G.

Figure 3

Alignment of deduced amino acid transcript sequences of the para-type sodium channel reanscripts (Cx-Na) in HAmCq^G0 Culex mosquitoes. Transmembrane segments are indicated on the line over the sequence. Exons are indicated above the sequence with solid triangle symbols to indicate the bounderies between exons. The differences in the aa sequences are indicated by shading. A stop codon is marked by an asterisk (*). - indicates deletions. ∆ indicates insertions with the sequences of ∆1: VSEITRTTAPTATAAGTAKARKVSA; ∆2: AA; ∆3: R; ∆4: *F; ∆5: L; ∆6: G.

Figure 3

Alignment of deduced amino acid transcript sequences of the para-type sodium channel reanscripts (Cx-Na) in HAmCq^G0 Culex mosquitoes. Transmembrane segments are indicated on the line over the sequence. Exons are indicated above the sequence with solid triangle symbols to indicate the bounderies between exons. The differences in the aa sequences are indicated by shading. A stop codon is marked by an asterisk (*). - indicates deletions. ∆ indicates insertions with the sequences of ∆1: VSEITRTTAPTATAAGTAKARKVSA; ∆2: AA; ∆3: R; ∆4: *F; ∆5: L; ∆6: G.

Figure 4

Alignment of deduced amino acid transcript sequences of the para-type sodium channel transcripts (Cx-Na) in HAmCq^G8 Culex mosquitoes. Transmembrane segments are indicated on the line over the sequence. Exons are indicated above the sequence with solid triangle symbols to indicate the bounderies between exons. The differences in the aa sequences are indicated by shading. A stop codon is marked by an asterisk (*). - indicates deletions. ∆ indicates insertions with the sequences of ∆1: GAIIVPVYYANL ∆2: GEQHSHLSWIWSE; ∆3: GEQHNHLSWIWSE; ∆4: VIGNSISNHQDNKLEHELNHRGMSLQ.

Figure 4

Alignment of deduced amino acid transcript sequences of the para-type sodium channel transcripts (Cx-Na) in HAmCq^G8 Culex mosquitoes. Transmembrane segments are indicated on the line over the sequence. Exons are indicated above the sequence with solid triangle symbols to indicate the bounderies between exons. The differences in the aa sequences are indicated by shading. A stop codon is marked by an asterisk (*). - indicates deletions. ∆ indicates insertions with the sequences of ∆1: GAIIVPVYYANL ∆2: GEQHSHLSWIWSE; ∆3: GEQHNHLSWIWSE; ∆4: VIGNSISNHQDNKLEHELNHRGMSLQ.

Figure 4

Alignment of deduced amino acid transcript sequences of the para-type sodium channel transcripts (Cx-Na) in HAmCq^G8 Culex mosquitoes. Transmembrane segments are indicated on the line over the sequence. Exons are indicated above the sequence with solid triangle symbols to indicate the bounderies between exons. The differences in the aa sequences are indicated by shading. A stop codon is marked by an asterisk (*). - indicates deletions. ∆ indicates insertions with the sequences of ∆1: GAIIVPVYYANL ∆2: GEQHSHLSWIWSE; ∆3: GEQHNHLSWIWSE; ∆4: VIGNSISNHQDNKLEHELNHRGMSLQ.

Figure 5

Alternative splicing of Cx-Nav from mosquitoes Culex quinquefasciatus. Boxes represent exons. The junctions of exons are indicated with straight lines or bridge lines. The schematic of the predicted 6 segments (S1 to S6) in each of the 4 domains (I, II, III, and IV) in the structure of Cx-Nav protein are shown. *The transcript had an entire ORF.

Figure 6

Expression of Cx-Nav in larvae and head+ thorax and abdomen tissues of 2-3 day-old female adult Culex mosquitoes. The relative level of gene expression shown along the Y axis represents the ratio of the gene expression in each tissue from the adults or larvae compared to that measured in the abdomen tissue of the same strain (ratio=1 indicates equal amounts). The experiments were performed three times. The results are shown as the mean ± S.E. No significant difference (P≤0.05) in the levels of sodium channel transcript expression was found in samples labeled with the same alphabetic letter (i.e., a, b, or c).