Attributes of Oct4 in stem cell biology: perspectives on cancer stem cells of the ovary

Abstract

Epithelial ovarian cancer (EOC) remains the most lethal of all the gynaecological malignancies with drug resistance and recurrence remaining the major therapeutic barrier in the management of the disease. Although several studies have been undertaken to understand the mechanisms responsible for chemoresistance and subsequent recurrence in EOC, the exact mechanisms associated with chemoresistance/recurrence continue to remain elusive. Recent studies have shown that the parallel characteristics commonly seen between embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSC) are also shared by a relatively rare population of cells within tumors that display stem cell-like features. These cells, termed 'cancer initiating cells' or 'cancer stem cells (CSCs)' have been shown not only to display increased self renewal and pluripotent abilities as seen in ESCs and iPSCs, but are also highly tumorigenic in in vivo mouse models. Additionally, these CSCs have been implicated in tumor recurrence and chemoresistance, and when isolated have consistently shown to express the master pluripotency and embryonic stem cell regulating gene Oct4. This article reviews the involvement of Oct4 in cancer progression and chemoresistance, with emphasis on ovarian cancer. Overall, we highlight why ovarian cancer patients, who initially respond to conventional chemotherapy subsequently relapse with recurrent chemoresistant disease that is essentially incurable.

Figure 1

A schematic diagram representing the human Oct4 isoforms. Both Oct4A and Oct4B share identical exons 2–5. The differences between the two isoforms lie in exon 1. The self-renewal and pluripotent properties of Oct4 encoded in exon 1 (Adapted from [97] and [96]).

Figure 2

mRNA expression of OCT4A in isolated cells obtained from chemonaive and chemoresistant ovarian cancer patients. Ascites cells were isolated as described previously [10]. RNA extractions, cDNA synthesis and quantitative determination of mRNA levels of Oct4A were performed as previously described [99]. Sense and antisense primers were designed against published human sequences for Oct4A (Entrez Gene ID 5460, approved symbol POU5F1): forward- CTCCTGGAGGGCCAGGAATC; reverse- CCACATCGGCCTGTGTATAT; 18S (Entrez Gene ID 100008588, approved symbol RN18S1) forward-GTAACCCGTTGAACCCCATT; reverse-CCATCCAATCGGTAGTAGCG. Gel extraction of PCR products was performed using the QiaEX II Agarose gel extraction Kit (Qiagen Australia), as per the manufacturers’ protocol and quantified using the ND-1000 Nanodrop spectrophotometer (NanoDrop Technologies Inc Wilmington, DE, USA). Sequences and products were verified as described previously [99]. Results are expressed as the difference between the log2 transformed ΔCt values of the gene of interest to that of housekeeping gene (18S) ±SEM of five independent samples performed in triplicate. *P<0.05, significantly different in recurrent versus chemonaive ascites samples.

Figure 3

A model of Oct4A-mediated ovarian cancer evolution and progression in the ascites microenvironment. During the course of ovarian cancer progression a shedding of tumor cells into the peritoneum occurs. Here tumor cells survive as cellular aggregates/spheroids where CSC-enriched core cells of the spheroids serve as a niche for regenerating cells. During chemotherapy treatment the bulk of the differentiated tumor cells on the periphery of the spheroids are eradicated leaving behind CSC-enriched core tumor cells. These cells facilitate the self-renewal of chemotherapy surviving residual cells resulting in tumor recurrence.