Sigma factor RpoN (σ54) regulates pilE transcription in commensal Neisseria elongata

Abstract

Human-adapted Neisseria includes two pathogens, Neisseria gonorrhoeae and Neisseria meningitidis, and at least 13 species of commensals that colonize many of the same niches as the pathogens. The Type IV pilus plays an important role in the biology of pathogenic Neisseria. In these species, Sigma factor RpoD (σ(70)), Integration Host Factor, and repressors RegF and CrgA regulate transcription of pilE, the gene encoding the pilus structural subunit. The Type IV pilus is also a strictly conserved trait in commensal Neisseria. We present evidence that a different mechanism regulates pilE transcription in commensals. Using Neisseria elongata as a model, we show that Sigma factor RpoN (σ(54)), Integration Host Factor, and an activator we name Npa regulate pilE transcription. Taken in context with previous reports, our findings indicate pilE regulation switched from an RpoN- to an RpoD-dependent mechanism as pathogenic Neisseria diverged from commensals during evolution. Our findings have implications for the timing of Tfp expression and Tfp-mediated host cell interactions in these two groups of bacteria.

Fig. 1

A. Alignment of 84 pilE promoters from commensal and pathogenic Neisseria isolated from humans, aligned with the ATG start codon as a fixed point. The consensus RpoN recognition sequences at −12 and −24 appear at the bottom. Putative RpoN recognition sequences in pilE promoters are boxed in pink, and invariant bases are marked with an asterisk (*) below. The invariant GG and GC dinucleotides are mutagenesis targets. The established RpoD recognition sequences, which are present only in the pathogenic species, are boxed in blue. The TIS for pilE in N. gonorrhoeae (previously reported) and N. elongata (this study) are bolded. The pilE promoters in the 64 N. meningitidis (Nme) strains examined in this study fall into three groups. Group 1 (Nme¹, 29 strains) is represented by FAM18; Group 2 (Nme², 16 strains) by Z2491, and Group 3 (Nme³, 19 strains) by MC58. Nel, N. elongata; Nsi, N. sicca; Nmu, N. mucosa; Nsu, N. subflava; Nfl, N, flavescens; Nci, N. cinerea; Npo, N. polysaccharea; Nla, N. lactamica; Ngo, N. gonorrhoeae (12 strains examined). B. Schematic representation of domains of E. coli RpoN (established) and Neisseria RpoN (from deduced amino acid sequences). RpoN domains important for transcriptional activity in E. coli are shown at the top. The activator binding domain is highlighted by the grey box; the core binding domain by the yellow box; the Helix–Turn–Helix domain by the green box; and the ‘RpoN-box’ by the pink box.

Fig. 2

Production of pilin and pilE mRNA by N. elongata ΔrpoN mutants. A. Pilin levels in wt and ΔrpoN mutants of N. elongata and N. gonorrhoeae. Cells were grown to log phase, and proteins from whole cell lysates were separated by electrophoresis in a 16% SDS polyacrylamide gel and stained with Coomassie blue. Left panel: wt N. elongata 29315, 29315ΔpilE and 29315ΔrpoN. Right panel: wt N. gonorrhoeae MS11, MS11ΔpilE and MS11ΔrpoN. B. pilE mRNA levels in wt Nel 29315 and 29315ΔrpoN. mRNA levels in wt and ΔrpoN mutants of N. elongata and N. gonorrhoeae. pilE mRNA in log phase cells was measured by RT-PCR in the presence (RT) or absence (No-RT) of reverse transcriptase. Left panel: wt N. elongata 29315 and 29315ΔrpoN; right panel: wt N. gonorrhoeae MS11 and MS11ΔrpoN. Primers targeting 16S rRNA were used as a loading control and as a control for mRNA stability. Lanes labelled ‘C’ are controls for PCR reactions, performed either in the presence of DNA (RT) or H2O only (No-RT).

Fig. 3

Binding of N. elongata RpoN to pilE_Nel promoter DNA (PpilE). A. Binding of His-RpoN_Nel to a 207 bp PpilE_Nel fragment containing RpoN recognition sequences at −12 and −24 was determined by EMSA. Increasing concentrations of His-RpoN_Nel were incubated with 5 ng of DNA. The reaction products were separated in a 6% native polyacrylamide gel and stained with ethidium bromide. Arrow indicates position of DNA bound to His-RpoNNel. Arrowhead indicates position of unbound DNA. B. Binding of His-RpoN_Nel to the negative control, a similar sized DNA fragment from the N. elongata fnr open reading frame, which does not have RpoN recognition sequences. Arrowhead indicates position of unbound DNA.

Fig. 4

cis-acting elements important for pilE transcription in N. elongata. DNA encoding wt and mutated pilE promoter sequences (A to G) were fused to lacZ and the PpilENel::lacZ cassettes were inserted into a non-essential region of the Nel chromosome. β-Galactosidase assays were performed on the N. elongata reporter strains to measure promoter strength. ‘X’ indicates the mutated locus in each construct. The negative control strain contains a promoterless lacZ at the same location (see Experimental procedures). Mutations are as follows (see also Table S2). A: RpoN −12 sequence, GG>aa; B: RpoN −24 sequence, GC>aa; C: RpoN −12/−24 double mutant, GG>aa/GC>aa; D: IHF recognition sequence, TAAACAAATTGTTAAATAAAAAAT>TgcgCAAcgTGTgcAgTAAgcAAT; E: UAS1, TGTCATTCATACCAATCAGACA>GAGcattcGGaccCGG cagGTG; F: UAS2, TGTCAAATCTGCCGTAAAAATACA>cacCAAAaCTGCCGTccgAATgag; G: UAS3, TGACAAATAACTGACAAAA>TGACggcTccCTGACgccg. Bolded bases in each sequence are strictly conserved residues. Underlined nucleotides in wt UAS3 are the PilR-protected bases in the Pseudomonas pilin promoter (Jin et al., 1994). Substitutions generated by site-directed mutagenesis are shown in lower case. Values are the average of 3 independent experiments.

Fig. 5

Identification of the RpoN activator for pilE transcription in N. elongata. A. pilE mRNA levels in wt N. elongata 29315 and mutants ΔpilE, ΔrpoN, Δorf1, and Δorf3 were measured in log phase cells by RT-PCR in the presence (RT) or absence (No-RT) of reverse transcriptase. Primers targeting 16S rRNA were used as loading control and as control for RNA stability. Lanes labelled ‘C’ are controls for PCR reactions, performed either in the presence of DNA (RT) or H₂O only (No-RT). B. Effect of deletions in orf1 and orf3 on pilE promoter activity in N. elongata. Promoter activity was determined in reporter strains containing a PpilENel::lacZ cassette in a non-essential region of the N. elongata chromosome. β-Galactosidase assays were used to measure promoter activity in log phase cells. The negative control strain ‘C’ contains a promoterless lacZ in the same location.

Fig. 6

Binding of purified His-Npa_Nel to PpilENel. Binding of His-Npa_Nel to the 240 bp PpilE_Nel was determined by the EMSA. Increasing concentrations of His-Npa_Nel were incubated with 15 ng of wt PpilE_Nel or PpilE_Nel with mutations in UAS1, UAS2 and UAS3. The reaction products were separated in a 6% native polyacrylamide gel and stained with ethidium bromide. UAS mutations are listed in the legend to Fig. 4 and Table 2. Arrow indicates position of DNA bound to His-NpaNel. Arrowhead indicates position of unbound DNA.