Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation
. 2013:2013:307145.
doi: 10.1155/2013/307145. Epub 2013 Jul 11.

miR156- and miR171-binding sites in the protein-coding sequences of several plant genes

Assyl Bari  1 , Saltanat Orazova, Anatoliy Ivashchenko
Affiliations

miR156- and miR171-binding sites in the protein-coding sequences of several plant genes

Assyl Bari et al. Biomed Res Int. 2013.

Abstract

We identified the interaction sites of several miRNAs with the mRNAs from paralogs and orthologs of the SPL and HAM genes in A. thaliana. miRNAs from the miR156 and miR157 families in A. thaliana are shown to have binding sites within the mRNAs of SPL genes. The ath-miR156a-j binding sites located in the mRNAs of the SPL paralogs contain the sequence GUGCUCUCUCUCUUCUGUCA. This sequence encodes the ALSLLS motif. miR157a-d bind to mRNAs of the SPL family at the same site. We suggest merging the miR156 and miR157 families into one family. Several SPL genes in eight plants contain conserved miR156 binding sites. GUGCUCUCUCUCUUCUGUCA polynucleotide is homologous in its binding sites. The ALSLLS hexapeptide is also conserved in the SPL proteins from these plants. Binding sites for ath-miR171a-c and ath-miR170 in HAM1, HAM2, and HAM3 paralog mRNAs are located in the CDSs. The conserved miRNA binding sequence GAUAUUGGCGCGGCUCAAUCA encodes the ILARLN hexapeptide. Nucleotides within the HAM1, HAM2, and HAM3 miRNA binding sites are conserved in the mRNAs of 37 orthologs from 13 plants. The miR171- and miR170-binding sites within the ortholog mRNAs were conserved and encode the ILARLN motif. We suggest that the ath-miR170 and ath-miR171a-c families should be in one family.

PubMed Disclaimer

Figures

Figure 1
Figure 1
The variability of nucleotides (a) in the binding sites of miR156a with mRNA of SPL paralogs and the variability of amino acids (b) in SPL proteins containing the ALSLLS hexapeptide in A. thaliana.
Figure 2
Figure 2
The variability of nucleotides (a) in the binding sites of miR156a with mRNAs of SPL orthologs and the variability of amino acids (b) in SPL proteins that contain the ALSLLS hexapeptide.
See this image and copyright information in PMC

References

    1. Cuperus JT, Fahlgren N, Carrington JC. Evolution and functional diversification of MIRNA genes. Plant Cell. 2011;23(2):431–442. - PMC - PubMed
    1. Tang Z, Zhang L, Xu C, et al. Uncovering small RNA-mediated responses to cold stress in a wheat thermosensitive genic male-sterile line by deep sequencing. Plant Physiology. 2012;159(2):721–738. - PMC - PubMed
    1. Wu G, Poethig RS. Temporal regulation of shoot development in Arabidopsis thaliana by miRr156 and its target SPL3. Development. 2006;133(18):3539–3547. - PMC - PubMed
    1. Yamaguchi A, Wu M-F, Yang L, Wu G, Poethig RS, Wagner D. The MicroRNA-regulated SBP-Box transcription factor SPL3 is a direct upstream activator of LEAFY, FRUITFULL, and APETALA1 . Developmental Cell. 2009;17(2):268–278. - PMC - PubMed
    1. Schwarz S, Grande AV, Bujdoso N, Saedler H, Huijser P. The microRNA regulated SBP-box genes SPL9 and SPL15 control shoot maturation in Arabidopsis. Plant Molecular Biology. 2008;67(1-2):183–195. - PMC - PubMed

Publication types

MeSH terms