Structure of a PLS-class pentatricopeptide repeat protein provides insights into mechanism of RNA recognition

Abstract

Pentatricopeptide repeat (PPR) proteins are sequence-specific RNA-binding proteins that form a pervasive family of proteins conserved in yeast, plants, and humans. The plant PPR proteins are grouped mainly into the P and PLS classes. Here, we report the crystal structure of a PLS-class PPR protein from Arabidopsis thaliana called THA8L (THA8-like) at 2.0 Å. THA8L resembles THA8 (thylakoid assembly 8), a protein that is required for the splicing of specific group II introns of genes involved in biogenesis of chloroplast thylakoid membranes. The THA8L structure contains three P-type PPR motifs flanked by one L-type motif and one S-type motif. We identified several putative THA8L-binding sites, enriched with purine sequences, in the group II introns. Importantly, THA8L has strong binding preference for single-stranded RNA over single-stranded DNA or double-stranded RNA. Structural analysis revealed that THA8L contains two extensive patches of positively charged residues next to the residues that are proposed to comprise the RNA-binding codes. Mutations in these two positively charged patches greatly reduced THA8L RNA-binding activity. On the basis of these data, we constructed a model of THA8L-RNA binding that is dependent on two forces: one is the interaction between nucleotide bases and specific amino acids in the PPR motifs (codes), and the other is the interaction between the negatively charged RNA backbone and positively charged residues of PPR motifs. Together, these results further our understanding of the mechanism of PPR protein-RNA interactions.

Keywords: Chloroplast; Crystal Structure; Pentatricopeptide Repeat (PPR) Protein; Plant Biochemistry; RNA Processing; RNA-binding Protein; THA8.

FIGURE 1.

Structure of Arabidopsis THA8L. A, sequence alignment of Zea mays THA8 (ZeTHA8), AtTHA8, and AtTHA8L. The secondary structure elements are indicated below the sequences. Chloroplast signal peptides are excluded from the sequences. The alignment was done by ClustalW. B, two 90° views of the THA8L structure. Note that the THA8L structure contains 11 α-helices; the first 10 helices comprise five PPR motifs, and the final short helix helps to cap the fifth PPR motif. The first PPR motif is L-type, followed by three P-type motifs and a shorter S-type motif that has 31 amino acids. C, two views of THA8L surface charge potential with blue for positive charges, red for negative charges, and white for neutral surface.

FIGURE 2.

THA8L binds to specific RNA sequences in ycf3 intron 2. A, sequence alignment of conserved RNA elements of ycf3 intron 2 from Z. mays (Zea), O. sativa (Os), A. thaliana (At), and G. max (Cs). Zea_1a, Zea₂, and Zea₄ are three putative binding sites of THA8 in the ycf3 intron 2. B, diagram of AlphaScreen assays for detecting THA8L-RNA binding. C, THA8L-RNA binding was detected by AlphaScreen assay. Significant binding signals were detected with 12.5 and 50 nm biotin-Zea_1a RNA and 100 nm His₆-AtTH8L. HB9, PB7, and HCB (control biotin-RNAs that bind other PPR proteins) showed weak or no binding to His₆-THA8L. All RNA sequences used for binding assays are listed below. D, RNA binding assay of THA8 and AtTHA8 with biotin-Zea_1a RNA at a ratio of 1:1 showed that THA8 has the highest affinity for biotin-Zea_1a RNA. AtTHA8 showed a significant RNA binding signal at a concentration of 80 nm, whereas THA8 showed significant binding to biotin-Zea_1a RNA at concentrations of 12.5 and 20 nm. His₆-ZeTHA8, His-Z. mays THA8. E, gel mobility shift assay was performed to detect RNA binding by THA8L protein. Increasing amounts of THA8L (0, 1, 4, and 8 μm) were incubated with 1 ng of labeled Zea₄ RNA or HB9 (control RNA). Protein-RNA complex formation was detected for Zea₄ RNA, but not for HB9 RNA (negative control).

FIGURE 3.

Minimum THA8L-binding RNA sequences. Nine RNA oligonucleotides with progressive 5′- and 3′-truncations of the original 21 nucleotides (AAGAAAGGAGGAAAUUUUCUA) without a biotin tag were used for competing the interaction between biotin-Zea_1a RNA and His-THA8L (H6-THA8L). RNA-1 to RNA-7 efficiently competed for the binding between biotin-Zea_1a RNA and His-tagged THA8L, whereas RNA-8 and RNA-9 had greatly reduced competition ability, indicating that RNA-7 (AGGAAAUUUUC) with 11 nucleotides has the minimum length for binding of THA8L. RNA sequences for the competition assay are listed.

FIGURE 4.

THA8L recognizes the Zea₄ ssRNA fragment specifically. A, relative affinities of various 13-nucleotide THA8L RNA-binding sites from different species as shown by RNA competition assays. RNA Zea₄ had the strongest competition ability, thus the strongest binding affinity for THA8L. H6-THA8L, His₆-THA8L. B, the binding signal of THA8L with different nucleic acids of Zea₄ demonstrated the order of competition capacity from strong to weak: ssRNA > RNA/DNA duplex > dsRNA > ssDNA > dsDNA. Different concentrations of ssRNA, dsRNA, RNA/DNA duplex, ssDNA, and dsDNA were used to compete the binding signals of His₆-THA8L/biotin-Zea_1a RNA. C, IC₅₀ and -fold affinity of different nucleic acids of Zea₄ listed as a decreased order of competition capability. The IC₅₀ values were derived from curve fitting based on a competitive inhibitor model for competition of the binding of His₆-THA8L and biotin-Zea_1a RNA.

FIGURE 5.

Arg and Lys of THA8L play an important role in PPR-RNA binding. A, effects of charge mutations on RNA binding measured by AlphaScreen assays. 12 of the 19 mutations reduced the binding of THA8L to RNA, and mutations at Lys-75, Arg-104, Lys-115, and Arg-119, nearly abolished RNA binding. B, SDS-PAGE of the purified protein samples of all 19 mutant THA8L proteins used for RNA binding assay. C, analytic HPLC gel filtration confirmed that all of the mutant proteins were properly folded. No aggregation/misfolding signals could be detected, and the main peaks of wild-type THA8L and mutants K75E, R104E, and R119E appeared at ∼5.5 min. mAU, milli-absorbance units.

FIGURE 6.

Model of THA8L-RNA interaction. A, an alignment of THA8L PPR repeats identifies the PPR motif types and the amino acid codes at positions 6 and 1′ of each PPR motif of THA8L. Residues at positions 6 and 1′ that are predicted to be the binding codes are highlighted in orange. Predicted binding nucleotides and PPR motif types are shown. B, code residues at positions 6 and 1′ are colored in orange. Mutations of 12 positively charged residues that reduced the binding of THA8L to RNA are colored in magenta and are located on the same side as the predicted code residues. Seven mutations that had little effect on RNA binding are marked in blue and are located on the other side of the protein. An RNA-binding model in which the specific base contacts are on top of the PPR motifs with the corresponding phosphate backbone contact near the bottom of the PPR motifs is indicated by the two dashed lines.