Circadian clock control of Nox4 and reactive oxygen species in the vasculature

Abstract

Recent studies have shown that circadian clock disruption is associated with pathological remodeling in the arterial structure and vascular stiffness. Moreover, chronic circadian disruption is associated with dysfunction in endothelial responses and signaling. Reactive oxygen species have emerged as key regulators in vascular pathology. Previously, we have demonstrated that circadian clock dysfunction exacerbates superoxide production through eNOS uncoupling. To date, the impact of circadian clock mutation on vascular NADPH oxidase expression and function is not known. The goal in the current study was to determine if the circadian clock controls vascular Nox4 expression and hydrogen peroxide formation in arteries, particularly in endothelial and vascular smooth muscle cells. In aorta, there was an increase in hydrogen peroxide and Nox4 expression in mice with a dysfunctional circadian rhythm (Bmal1-KO mice). In addition, the Nox4 gene promoter is activated by the core circadian transcription factors. Lastly, in synchronized cultured human endothelial cells, Nox4 gene expression exhibited rhythmic oscillations. These data reveal that the circadian clock plays an important role in the control of Nox4 and disruption of the clock leads to subsequent production of reaction oxygen species.

Figure 1. Increased Nox4 gene expression in aorta of Bmal1-KO mice.

Aortae from WT and Bmal1-KO mice were isolated between ZT2 and ZT4, cryopreserved and total RNA isolated. Relative gene expression was assessed by qRT-PCR for Nox4 (forward primer, TGTTGCATGTTTCAGGTGGT; reverse, AAAACCCTCGAGGCAAAGAT) and Nox1(forward primer, CATGGCCTGGGTGGGATTGT; reverse, TGGGAGCGATAAAAGCGAAGGA) in mouse aorta and normalized to 18S. Bmal1-KO mice exhibited a significant increase in Nox4 gene expression (*P<0.05, n=6).

Figure 2. Increased Nox4 protein expression in cultured aortic endothelial and smooth muscle cells of Bmal1-KO mice.

Vascular smooth muscle and endothelial cells were isolated and cultured from aortae of WT and Bmal1-KO mice (passage 2-3). Nox4 expression levels were determined by immunoblotting and revealed a significant increase in Nox4 in vascular endothelial cells (A) and smooth muscle cells (B) from Bmal1-KO animals relative to wild-type mice. Changes were quantified by densitometry (^*p<0.05 versus WT, n=3).

Figure 3. Nox4 promoter is regulated by the circadian clock.

Human Nox4 promoter transactivation was assessed by a dual luciferase assay in transfected COS cells expressing the Nox4 promoter Gaussian luciferase in the presence and absence CLOCK, Bmal1, NPAS2, Bmal1+NPAS2 andBmal1+Clock. Cotransfection with Bmal1 and NPAS2 or Bmal1 and Clock significantly induced Nox4 promoter activity (*p<0.05 versus control, n=5).

Figure 4. Bmal1 knockdown increases hydrogen peroxide in human aortic smooth muscle cells.

(A) Western blot showing reduction in Bmal1 expression in human aortic smooth muscle cells incubated with antisense-Bmal1 adenovirus for 24 hours. (B) Knockdown of Bmal1 triggered an increase in H₂O₂ but (C) no detectable change in O₂ ^{. -} levels in human aortic smooth muscle cells (HASMC). (n=8, *p<0.05) (D) Relative expression of Bmal1 and Nox4 versus B-actin and GAPDH in human aortic smooth muscle cells transfected with siRNA-Bmal1or control siRNA (30nM, n=3-5).

Figure 5. Bmal1 knockdown increases hydrogen peroxide and superoxide in human aortic endothelial cells.

(A) Western blot showing reduction in Bmal1 expression in human aortic endothelial cells incubated with antisense-Bmal1 adenovirus. (B) Knockdown of Bmal1 resulted in increased H2O2 and superoxide (C) Relative expression of Bmal1 and Nox4 versus B-actin and GAPDH in human aortic endothelial cells transfected with siRNA-Bmal1or control siRNA (30nM, n=3-5). (D) Relative expression of Bmal1 and Nox4 versus β-actin and GAPDH in human aortic endothelial cells transfected with siRNA-Bmal1or control siRNA. Knockdown of Bmal1 increased Nox4 protein (n=8, *p<0.05 by one way ANOVA).

Figure 6. Circadian oscillation in Nox4 and Nox1 gene expression in cardiac and endothelial cells.

(A)WT and Bmal1-KO hearts were isolated at 4 hour intervals, cryopreserved and RNA isolated. WT mice exhibited a significant rhythm in Nox4 expression as demonstrated by cosinor analysis (p=0.047), that was absent in Bmal1-KO mice (p=0.68). Circadian clocks were synchronized in human aortic endothelial cells by horse serum shock (20%), and cell lysates were harvested at 6-hour intervals for 24 hours. Expression levels of Nox4 (B) and Nox1 mRNA (C) at each time point were quantified by qRT-PCR. Nox4 and Nox1 exhibited a rhythmic expression pattern over 24 hours. (n=4-6).