Development of primary early-onset colorectal cancers due to biallelic mutations of the FANCD1/BRCA2 gene

Abstract

Fanconi anaemia (FA) is characterized by progressive bone marrow failure, congenital anomalies, and predisposition to malignancy. In a minority of cases, FA results from biallelic FANCD1/BRCA2 mutations that are associated with early-onset leukaemia and solid tumours. Here, we describe the clinical and molecular features of a remarkable family presenting with multiple primary colorectal cancers (CRCs) without detectable mutations in genes involved in the Mendelian predisposition to CRCs. We unexpectedly identified, despite the absence of clinical cardinal features of FA, a biallelic mutation of the FANCD1/BRCA2 corresponding to a frameshift alteration (c.1845_1846delCT, p.Asn615Lysfs*6) and a missense mutation (c.7802A>G, p.Tyr2601Cys). The diagnosis of FA was confirmed by the chromosomal analysis of lymphocytes. Reverse transcriptase (RT)-PCR analysis revealed that the c.7802A>G BRCA2 variation was in fact a splicing mutation that creates an aberrant splicing donor site and results partly into an aberrant transcript encoding a truncated protein (p.Tyr2601Trpfs*46). The atypical FA phenotype observed within this family was probably explained by the residual amount of BRCA2 with the point mutation c.7802A>G in the patients harbouring the biallelic FANCD1/BRCA2 mutations. Although this report is based in a single family, it suggests that CRCs may be part of the tumour spectrum associated with FANCD1/BRCA2 biallelic mutations and that the presence of such mutations should be considered in families with CRCs, even in the absence of cardinal features of FA.

Figure 1

Tree of the reported family. Closed symbols indicate patients affected with FA. Open symbols indicate patients unaffected with FA. The type of cancer and age at presentation (in brackets) are given under the symbol. BRCA2 mutations are added next to the symbol. Wt: wild type.

Figure 2

Forward and reverse BRCA2 sequence with the exon 10 mutation c.1845_1846delCT p.Asn615Lysfs*6.

Figure 3

Forward and reverse BRCA2 sequence with the missense variant c.7802A>G p.Tyr2601Cys in exon 16.

Figure 4

In silico analysis using Alamut software: appearance of a de novo 5′ splicing site (GU), located four nucleotides upstream of the physiological 5′ splicing site, suggesting a splice anomaly. The strength of this de novo 5′ splicing site is equivalent to the physiological 5′ splicing site, with scores of 74,1 versus 74,7 according to the human splicing finder.

Figure 5

(a) cDNA forward sequence of the mutant c.7802A>G and control patient. A: TTTTATAGGGCTCTGTGTGACACT: allele wild type: 50% of transcript. B: TTTTGTAGGGCTCTGTGTGACACT: transcript with c.7802A>G without nucleotide deletion: r.7802a>g p.Tyr2601Cys: 25% of transcript. C: TTTTGGCTCTGTGTGACACTCCAG: transcript with c.7802A>G: truncated transcript r.7802_7805delauag p.Tyr2601Trpfs*46: 25% of transcript. (b) cDNA reverse sequence; mutant c.7802A>G. A: AGTGTCACACAGAGCCCTATAAAATT: allele WT: 50% of transcript. B: AGTGTCACACAGAGCCCTACAAAATT: transcript c.7802A>G without nucleotide deletion: r.7802a>g p.Tyr2601Cys: 25% of transcript. C: AGTGTCACACAGAGCCAAAATTCTTC: transcript with c.7802A>G: truncated transcript r.7802_7805delauag p.Tyr2601Trpfs*46: 25% of transcript. (c) Zoom illustrating triple peak.