Identification of a Bombyx mori gene encoding small heat shock protein BmHsp27.4 expressed in response to high-temperature stress

Abstract

Elucidating the mechanisms underlying the response and resistance to high-temperature stress in the Lepidoptera is essential for understanding the effect of high-temperature on the regulation of gene expression. A tag (CATGAACGTGAAGAGATTCAG) matching the predicted gene BGIBMGA005823-TA in SilkDB identified the most significant response to high-temperature stress in a screen of the heat-treated digital gene expression library of Bombyx mori (B. mori) (Unpublished data). BLAST and RACE showed that the gene is located on chromosome 5 and has an open reading frame (ORF) of 741bp. Phylogenetic analysis found that B. mori small heat shock protein 27.4 (BmHSP27.4) is in an evolutionary branch separate from other small heat shock proteins. Expression analysis showed that BmHsp27.4 is highly expressed in brain, eyes and fat bodies in B. mori. Its mRNA level was elevated at high-temperature and this increase was greater in females. The ORF without the signal peptide sequence was cloned into vector pET-28a(+), transformed and over-expressed in Escherichia coli Rosetta (DE3). Western blotting and immunofluorescence analysis with a polyclonal antibody, confirmed that the level of protein BmHSP27.4 increased at a high-temperature, in accordance with its increased mRNA level. In this study, BmHsp27.4 was identified as a novel B. mori gene with an important role in response to high-temperature stress.

Keywords: Bombyx mori; Immunofluorescence; Prokaryotic expression; Small heat shock protein.