Scrutinizing virus genome termini by high-throughput sequencing

Abstract

Analysis of genomic terminal sequences has been a major step in studies on viral DNA replication and packaging mechanisms. However, traditional methods to study genome termini are challenging due to the time-consuming protocols and their inefficiency where critical details are lost easily. Recent advances in next generation sequencing (NGS) have enabled it to be a powerful tool to study genome termini. In this study, using NGS we sequenced one iridovirus genome and twenty phage genomes and confirmed for the first time that the high frequency sequences (HFSs) found in the NGS reads are indeed the terminal sequences of viral genomes. Further, we established a criterion to distinguish the type of termini and the viral packaging mode. We also obtained additional terminal details such as terminal repeats, multi-termini, asymmetric termini. With this approach, we were able to simultaneously detect details of the genome termini as well as obtain the complete sequence of bacteriophage genomes. Theoretically, this application can be further extended to analyze larger and more complicated genomes of plant and animal viruses. This study proposed a novel and efficient method for research on viral replication, packaging, terminase activity, transcription regulation, and metabolism of the host cell.

Figure 1. Phylogenetic analysis of large terminase subunits from 17 phages sequenced in this study and their comparison to other phages with known packaging mechanisms.

Phages sequenced in this study are indicated by arrows. The tree was generated from an amino acid alignment (gap open cost, 10; gap extension cost, 1; end gap cost, free) using the Maximum Likelihood method with 1000 bootstrap replicates (MEGA 5.10).

Figure 2. Frequencies of reads representing the genome termini of phage T3.

(A) Adaptor tagged genomic DNA. (B) Un-tagged genomic DNA. Strand orientation and nucleotide numbering are adopted from the complete genome sequence record of T3 phage in GenBank (NC_003298).

Figure 3. The highest frequency sequence and their surrounding 20 bp.

Sequences with extraordinary high frequencies (with low frequencies of nearby sites) can be called true termini such as in T4-like phage IME08, IME09 and Staphylococcus aureus phage IME-SA1. N4-like phage IME11 have distinctive terminal sequences at the left while at the right end there are two termini separated by two bases.

Figure 4. Schematic map of 401 bp direct terminal repeats in the N4-Like phage IME11 genome.

F1 (62722) is the forward cleavage site in the genome (packaging from 1 to 62722). R1 (401) and R2 are the reverse cleavage sites (packaging from 63123 to 401).

Figure 5. Distribution of the top 15 forward and reverse HFSs in the N4-like bacteriophage IME11 genome.

One HFS is on the left end while the other two are on the right end. Their frequencies are 486, 240 and 180, respectively (black rhombus: forward, gray square: reverse).

Figure 6. The highest frequency sequences (forward – F, reverse – R) with the surrounding 500 bp.

Although most 500(F) and 527 times (R).

Figure 7. Consensus sequence of the top 10 HFSs together with their upstream sequence.

Height of the base represents the degree of conservation. Start site of HFSs is at position 11.

Figure 8. Schematic map of direct terminal repeats and forward/reverse terminase cleavage sites distribution in bacteriophage T3.

(A) The whole genome length of bacteriophage T3 is 38,208 bp. There are two forward and reverse terminase cleavage sites at 137,978 and 23,138,208 respectively, which indicates that there are 230 bp repeats on the T3 genome, both A – C or A – D can serve as the whole genome. (B) The same as (A), both F1/R1 and F2/R2 can serve as the forward and reverse cleavage sites. There are 230 bp repeats on bacteriophage T3 genome. F1/F2: TCTCATAGTTCAAGAACCCA, R1/R2: AGGGACACATAGAGATGTAC.

Figure 9. The top 15 forward and reverse HFSs of indicated phage genomes.

T4-like phages IME08, IME09, IME-EC1, Iridovirus W150 have preferred termini, which have multi-termini throughout the entire genome. T7-like phage T3, IME-EC-16, IME-EC-17, IME-SF1, IME-SF2, E. faecalis phage IME-EF3,IME-EF4, S. aureus phage IME-SA1,IME-SA2 and IME-SA3, N4-like bacteriophages IME11, Escherichia coli phage IME-EC2, Enterococcus faecium phage IME-EFm1, and Serratia marcescens phage IME-SM1 have fixed termini. Only one forward and reverse HFS are located at the two ends of T3, IME-EC-16, IME-EC-17, IME-EF3, IME-EFm1, IME-SF1, IME-SF2, IME-SM1, one forward HFS at the left end of N4-like phage IME11, S. aureus phage IME-SA1, IME-SA2, IME-SA3, and one reverse HFS at the right end of IME-EC2, E. faecalis phage IME-EF4 (unique termini). N4-like phage IME11 has two right ends (multi-termini), S. aureus phage IME-SA1, IME-SA2, IME-SA3 have random right ends and E. faecalis phage IME-EF4 and IME-EC2 have random left end (Red: forward, Black: reverse, dot: preferred termini, plus sign: fixed but with unique differences in the forward and reverse termini, rhombus: unique termini at both ends).