Flock house virus RNA polymerase initiates RNA synthesis de novo and possesses a terminal nucleotidyl transferase activity

Abstract

Flock House virus (FHV) is a positive-stranded RNA virus with a bipartite genome of RNAs, RNA1 and RNA2, and belongs to the family Nodaviridae. As the most extensively studied nodavirus, FHV has become a well-recognized model for studying various aspects of RNA virology, particularly viral RNA replication and antiviral innate immunity. FHV RNA1 encodes protein A, which is an RNA-dependent RNA polymerase (RdRP) and functions as the sole viral replicase protein responsible for RNA replication. Although the RNA replication of FHV has been studied in considerable detail, the mechanism employed by FHV protein A to initiate RNA synthesis has not been determined. In this study, we characterized the RdRP activity of FHV protein A in detail and revealed that it can initiate RNA synthesis via a de novo (primer-independent) mechanism. Moreover, we found that FHV protein A also possesses a terminal nucleotidyl transferase (TNTase) activity, which was able to restore the nucleotide loss at the 3'-end initiation site of RNA template to rescue RNA synthesis initiation in vitro, and may function as a rescue and protection mechanism to protect the 3' initiation site, and ensure the efficiency and accuracy of viral RNA synthesis. Altogether, our study establishes the de novo initiation mechanism of RdRP and the terminal rescue mechanism of TNTase for FHV protein A, and represents an important advance toward understanding FHV RNA replication.

Figure 1. FHV protein A possesses RdRP activity.

(A) Electrophoresis analysis of purified MBP-Pro A and its mutants. Lane M, molecular weight markers (in kDa); Lane 1, MBP-Pro A; Lane 2, MBP-Pro A_GAA, the MBP fusion GDD-to-GAA mutant protein A. (B) Schematic of the RNA templates used for RdRP assays. (C) The indicated template, intact or with its 3′ end blocked via oxidation, was incubated with the indicated proteins and DIG RNA Labeling mix. The reaction products were by electrophoresis on a denaturing formaldehyde-agarose gel and detected.Lane 1, synthesized DIG-labeled RNA at the designated size (200 nt) generated by T7 polymerase-mediated in vitro transcription (D) The blocked template (−)-RNA1_1–201 was incubated with the indicated proteins. Templates and reaction products were analyzed and detected as in (C). (E) The blocked template (+)-RNA1_1–191 was incubated with the indicated proteins. Templates and reaction products were analyzed on denaturing formaldehyde-agarose gel and detected via Northern blot analysis using the DIG-labeled probes 2 and DIG-labeled probes 3 (GUUCUAGCCCGAAAGGGCAGAGGU). (F) The RNA products synthesized in (C) and (D) were subjected to RT-PCR. Reverse transcription was conducted in the presence or absence of specific RT primers, followed by PCR amplification. PCR products were electrophoresed through 1.0% agarose gel and visualized by ethidium bromide staining. Lane 1, DNA ladder.

Figure 2. FHV protein A initiates RNA synthesis via a de novo mechanism.

(A) The template, (−)-RNA1_1–201 with its 3′-end blocked, was incubated with the MBP-Pro A and different concentrations specific RNA primer. Reaction products were analyzed on denaturing formaldehyde-agarose gel and detected as described in “Materials and Methods”. Lane 1, synthesized DIG-labeled RNA at the designated size (200 nt) generated by T7 polymerase-mediated in vitro transcription. (B) The synthesized RNA products from the experiments in (A) were measured via Bio-Rad Quantity One software, and the relative RdRP activities were determined by comparing the RNA product level in the presence of the indicated concentration of primer with the RNA product level without the primer. Error bars represent the standard deviation (S.D.) values from at least three independently repeated experiments.

Figure 3. Effects of different reaction conditions on de novo RNA synthesis.

(A) The template, (−)-RNA1_1–201 with its 3′-end blocked, was incubated with the MBP-Pro A at different temperature. Reaction products were analyzed on denaturing formaldehyde-agarose gel and detected as described in “Materials and Methods”. Lane 1, synthesized DIG-labeled RNA at the designated size (200 nt) generated by T7 polymerase-mediated in vitro transcription. (B) The synthesized RNA products from the experiments in (A) were measured via Bio-Rad Quantity One software Error bars represent the standard deviation (S.D.) values from at least three independently repeated experiments. (C) The template (−)-RNA1_1–201 with its 3′-end blocked, was incubated with the MBP-Pro A at the different pH. Reaction products were analyzed on denaturing formaldehyde-agarose gel and detected as described in “Materials and Methods”. Lane 1, synthesized DIG-labeled RNA at the designated size (200 nt) generated by T7 polymerase-mediated in vitro transcription. (D) The synthesized RNA products from the experiments in (C) were measured via Bio-Rad Quantity One software Error bars represent the standard deviation (S.D.) values from at least three independently repeated experiments. (E) The template, (−)-RNA1_1–201 with its 3′-end blocked, was incubated with the MBP-Pro A and different concentrations of Mn²⁺. Reaction products were analyzed on denaturing formaldehyde-agarose gel and detected as described in “Materials and Methods”. Lane 1, synthesized DIG-labeled RNA at the designated size (200 nt) generated by T7 polymerase-mediated in vitro transcription. (F) The synthesized RNA products from the experiments in (E) were measured via Bio-Rad Quantity One software Error bars represent the standard deviation (S.D.) values from at least three independently repeated experiments.

Figure 4. Effects of RdRP inhibitors.

(A) The blocked (+)-RNA1_1–191 template was reacted with MBP-Pro A under the presence or absence of indicated conditions, such as standard condition (lane 2), heat at 95°C for 2 min (lane 3), 20 mM EDTA (lane 4), or 0.6% SDS (lane 5). Lane 1, synthesized DIG-labeled RNA at the designated size (200 nt) generated by T7 polymerase-mediated in vitro transcription. (B) The blocked (+)-RNA1_1–191 template was reacted with MBP-Pro A in the presence of RdRP inhibitor PAA (lanes 3–5) or gliotoxin (lanes 6–8) at the indicated concentrations. Lane 1, DIG-labeled RNA at the designated size (200 nt) generated by T7 polymerase. The reaction products were analyzed on denaturing formaldehyde-agarose gel and detected as described in “Materials and Methods”.

Figure 5. FHV protein A possesses TNTase activity.

(A) The (−)-RNA1_1–201 substrate was reacted with MBP-Pro A with DIG-labeled UTP mix (65% DIG-labeled UTP together with 35% UTP) in the absence (lane 3) or presence of indicated NTPs (lanes 2, 4–9). (B) The (−)-RNA1_1–201 (lanes 1–4) or (+)-RNA1_1–191 (lanes 5–8) substrates as well as DIG-labeled UTP mix were reacted with MBP-Pro A or MBP-Pro A_GAA as indicated, in the absence (lanes 1, 2, 5, and 6) or presence (lanes 3, 4, 7 and 8) of ATP, CTP, and GTP mix. (C) The (−)-RNA1_1–201 (lanes 2–5) or (+)-RNA1_1–191 (lanes 6–9) substrates were intact (lanes 2, 3, 6 and 7) or 3′-end blocked by oxidation (lanes 4, 5, 8 and 9). The indicated substrates were incubated with DIG-labeled UTP mix in the presence or absence of ATP, CTP, and GTP mix. For (A–C), the substrates and TNTase reaction products were analyzed and detected as described in “Materials and Methods”.

Figure 6. The RdRP activities of protein A depend on the 3′-proximal nucleotides of RNA1.

(A) The (−)RNA and (+)RNA templates/substrates with different 3′-end sequences are shown. (B) The 3′-OH blocked (+)RNA templates with 3′ -proximal deletion of 0 to 49 nucleotides (lanes 2–7) were reacted with MBP-Pro A as indicated. The templates and RdRP reaction products were analyzed on denaturing formaldehyde-agarose gel and detected as described in “Materials and Methods”. (C) The 3′-OH blocked (−)RNA substrates with 3′-proximal deletion of 0 to 7 nucleotides (lanes 2–6) were reacted with MBP-Pro A as indicated. The substrates and reaction products were analyzed and detected as described in “Materials and Methods”. (D) The blocked (−)-RNA1_1–201A3G, (−)-RNA1_1–201A3C and (−)-RNA1_1–201A3U were reacted with MBP-Pro A. Templates and reaction products were analyzed and detected as described in “Materials and Methods”. (E) The blocked (−)-RNA1_3–201A3G, (−)-RNA1_3–201A3C and (−)-RNA1_3–201A3U templates were reacted with MBP-Pro A. Templates and reaction products were analyzed and detected as described in “Materials and Methods”. For (B-E), lane 1 represents synthesized DIG-labeled RNA at the designated size (200 nt) generated by T7 polymerase-mediated in vitro transcription.

Figure 7. The TNTase activity of protein A can restore the replication competency of the templates with 3′-terminal nucleotide deletion.

(A) The (−)RNA substrates with 3′-proximal deletion of 0 to 6 nucleotides (lanes 2–7) were reacted with MBP-Pro A and DIG-labeled UTP mix as indicated. The substrates and reaction products were analyzed and detected as described in “Materials and Methods”. (B) Schematic of the experimental procedures used in (C). (C) The RNA templates, (−)-RNA1_4–201 (lane2–4) and (−)-RNA1_3–201A3U (lane5–7) were reacted with indicated protein. Templates and reaction products were analyzed and detected as described in “Materials and Methods”. For (A,C), lane 1 represents synthesized DIG-labeled RNA at the designated size (200 nt) generated by T7 polymerase-mediated in vitro transcription.