Porcine circovirus type 2 in China: an update on and insights to its prevalence and control

Abstract

Currently, porcine circovirus type 2 (PCV2) is considered the major pathogen of porcine circovirus associated-diseases (PCVAD) that causes large economic losses for the swine industry in the world annually, including China. Since the first report of PCV2 in 1998, it has been drawing tremendous attention for the government, farming enterprises, farmers, and veterinary practitioners. Chinese researchers have conducted a number of molecular epidemiological work on PCV2 by molecular approaches in the past several years, which has resulted in the identification of novel PCV2 genotypes and PCV2-like agents as well as the description of new prevalence patterns. Since late 2009, commercial PCV2 vaccines, including the subunit vaccines and inactivated vaccines, have already been used in Chinese swine farms. The aim of this review is to update the insights into the prevalence and control of PCV2 in China, which would contribute to understanding the epidemiology, control measures and design of novel vaccines for PCV2.

Figure 1

Genome maps of PCV1 and PCV2. Note: Generally, maps of PCV2a & PCV2e, PCV2b, PCV2d & PCV2c, are corresponding to Map 1 (PCV2), Map 2 (PCV2) and Map 3 (PCV2), respectively.

Figure 2

Life cycles of PCV. Note: The figure was showed in the previous reference [8]. Abbreviations: Glycosaminoglycans (GAG); Rolling-circle replication (RCR); Minimal binding site (MBS).

Figure 3

Phylogenetic analysis of diversified PCV strains. Note: The phylogenetic tree was constructed using the neighbor-joining method with MEGA 5.1 software. The reliability of the different phylogenetic groupings was evaluated by using the bootstrap test (1000 bootstrap replications).

Figure 4

Genome maps of four deletion strains and two insertion strains of PCV2. For TZ0601 and YJ, the nucleotide (G) deletion occurred at position 1059 and 1039, respectively. AH and MDJ had an identical nucleotide (G) deletion at position 39. Moreover, for two insertion strains, 10JS-2 had 11-nt (AGCAGCACCTC) insertion at position 42, while JF2 had one nucleotide (T) insertion at position 1043.

Figure 5

Genome maps of four PCV2 recombinant strains. HN0907 was an intra-genotypic recombinant between PCV2b strains, nucleotides (Position 51 to 413) were from ZhuJi2003 (AY579893, PCV2b) and nucleotides (Position 414 to 995) were from 09CQ (HQ395024, PCV2b). 09HaiN-1 was an inter-genotypic recombinant between PCV2a and PCV2b strains, it exhibited greater similarity to 336 (AY256459, PCV2a) before the breakpoint 309 of ORF2, and shared higher sequence similarity with GSLN-PCV2 (FJ948168, PCV2b) after the breakpoint 309 of ORF2. SXXYA-01 was an inter-genotypic recombinant between PCV2a and PCV2b strains, nucleotides (Position 1034 to 1391) were most from ZhuJi2003 (AY579893) and the remaining sequences were most from DTC (DQ104423). SXXYB-01 was an inter-genotypic recombinant between PCV2a and PCV2b strains, its sequence exhibited higher similarity to DTC (DQ104423, PCV2a) before the breakpoint 1034 nt and higher similarity to ZhuJi2003 (AY579893, PCV2b) after the breakpoint 1034 nt. Note: The recombinant regions were presented using red squares and blue squares.

Figure 6

Genome maps of eight PCV2-like agents. For P1, twenty-two nucleotides (GGATCCACTAGTAACGGCCGCC) from 5'-terminal region might originate from porcine endogenous retroviruses and the rest of the sequence shared 98.42% identity with ORF2 of PCV2 genome (AF381175). For P2, its ORF3 sequences shared 64.7% ~ 97.4% identity with ORF2 of PCV genome. For JSTZ, ZJQDH1 and ZJQDH2, online Blastn results showed they shared hightest nucleotide identity (98% ~ 100%) with the partial sequences of PCV2 (the strain of GZ-CS1, JQ809462). For JSHM, online Blastn results showed it shared hightest nucleotide identity (98% ~ 100%) with the partial sequences of PCV2 (the strain of CQWZ12, KF742551). For CH-IVT1, online Blastn results showed it shared hightest nucleotide identity (100%) with the partial sequences of PCV2 (the strain of BF, AF381175). For BIV, online Blastn results showed it shared hightest nucleotide identity (99%) with the partial sequences of PCV2 (the strain of 10JS-2, JQ806749). Note: Complete genomes of P1 and P2 were showed in reference [78] and reference [76], respectively.

Figure 7

Possible infection and cross-species transmission routes of PCV in pigs.